DNA-protein Interaction Search Results

• DNA-protein Interaction

ANT-AP2R1R2 binds weakly to ... the ... COR15a sites

Nole-Wilson S, Krizek BA - DNA binding properties of the Arabidopsis floral development protein AINTEGUMENTA

• DNA-protein Interaction

ANT-AP2R1R2 binds weakly to ... the COR78 ... sites

Nole-Wilson S, Krizek BA - DNA binding properties of the Arabidopsis floral development protein AINTEGUMENTA

• DNA-protein Interaction

demonstrating a specific activation of AIR3 promoter by NAC1

Xie Q, Frugis G, Colgan D, Chua NH - Arabidopsis NAC1 transduces auxin signal downstream of TIR1 to promote lateral root development

• DNA-protein Interaction

To test NAC1 for this activity, a recombinant GST–NAC1 fusion protein was expressed in Escherichia coli, purified and assayed for DNA binding. Figure ​Figure2B2B shows that NAC1 was indeed able to bind to the 35S −90 promoter fragment (Fig. ​(Fig.2B,2B, cf. lanes 2–5 with 6–9). The −90 region of the 35S promoter is known to contain an AS1 element (TGACG), a binding site for bZIP transcription factors (Izawa et al. 1993). Therefore, the 20-bp segment (CTGACGTAAGGGATGACGCAC) from −83 to −63 that contains the AS1 element was used as probe and found to be recognized by GST–NAC1 (data not shown). However, when a fragment (CTGctGTA AGGGATGctGCAC) mutated in the AS1 element was tested, the binding was only partially affected (data not shown), whereas no binding activity was detected when the same mutant was tested with ASF-1, a member of bZIP transcription factors (Qin et al. 1994). These studies indicate that although the recognized sequence element is located within the −83 to −63 region, the sequence requirement is different from the AS1 element

Xie Q, Frugis G, Colgan D, Chua NH - Arabidopsis NAC1 transduces auxin signal downstream of TIR1 to promote lateral root development

• DNA-protein Interaction

Full-length ANT (ANT1–555) expressed in BK1 under the control of the ADH1 promoter produced high β-galactosidase activity, indicating that the ANT-binding site determined in vitro does function to control gene expression in vivo. DNA binding experiments previously indicated that both AP2 repeats are required for high affinity in vitro binding to this site (14). To determine whether both AP2 repeats were required for DNA binding in vivo, β-galactosidase activity was measured in yeast expressing ANT proteins lacking either the first (ANTΔ281–357) or second (ANTΔ383–451) AP2 repeat (Fig. ​(Fig.1).1). Neither ANTΔ383–451 nor ANTΔ281–357 was able to activate expression of the reporter gene (Fig. ​(Fig.1)1) while a construct lacking the C-terminal 104 amino acids (ANT1–451) conferred high levels of β-galactosidase activity. Since the transcriptional activation domain of ANT maps to the N-terminal half of the protein (C.Sulli and B.A.Krizek, unpublished observations), the loss of transcriptional activation when either AP2 repeat is missing suggests that binding to this site in vivo requires both AP2 repeats

Krizek BA - AINTEGUMENTA utilizes a mode of DNA recognition distinct from that used by proteins containing a single AP2 domain

• DNA-protein Interaction

ChIP was performed using antibodies to GFP, as described previously (Chua et al. 2001; Gendrel et al. 2001). Coprecipitated DNA was analyzed by PCR using primer pairs that amplify various regions of AS1 (Fig. 6D). In three independently transformed lines of 35S::GTE6-GFP plants, the GFP antibodies coprecipitated the promoter (region P2), and the 3′ end of the intron and the 5′ end of exon 2 (region P1) of AS1 ... GTE6 thus regulates expression by associating with a 1-kbp region containing the promoter and the start of the transcribed region of AS1, which are likely to be important regulatory regions for transcriptional control

Chua YL, Channelière S, Mott E, Gray JC - The bromodomain protein GTE6 controls leaf development in Arabidopsis by histone acetylation at ASYMMETRIC LEAVES1

• DNA-protein Interaction

Using surface plasmon resonance (SPR), we found that RHL1 binds to DNA in a concentration- and salt- dependent manner

Sugimoto-Shirasu K, Roberts GR, Stacey NJ, McCann MC, Maxwell A, Roberts K - RHL1 is an essential component of the plant DNA topoisomerase VI complex and is required for ploidy-dependent cell growth

• DNA-protein Interaction

The ability of ANT to regulate transcription in yeast was investigated using a fusion of full-length ANT to the GAL4 DNA binding domain (GBD; Fig. 1a). The lacZ reporter gene in the yeast strain HF7c was under the control of three GAL4 binding sites and the TATA part of the CYC1 promoter (Fig. 1b). The level of β-galactosidase activity was increased from 500-fold to 3,000-fold in yeast containing GBD–ANT1–555 as compared to those containing just the GAL4 DNA binding domain

Krizek BA, Sulli C - Mapping sequences required for nuclear localization and the transcriptional activation function of the Arabidopsis protein AINTEGUMENTA

• DNA-protein Interaction

The putative ANT binding sites in the FIL and YAB3 promoters match the in vitro-determined ANT consensus binding site in 10 of 14 conserved positions (Fig. 1A). Gel mobility shifts revealed that ANT binds in vitro to fragments of both promoters that contain these sequences

Nole-Wilson S, Krizek BA - AINTEGUMENTA contributes to organ polarity and regulates growth of lateral organs in combination with YABBY genes

• DNA-protein Interaction

The putative ANT binding sites in the FIL and YAB3 promoters match the in vitro-determined ANT consensus binding site in 10 of 14 conserved positions (Fig. 1A). Gel mobility shifts revealed that ANT binds in vitro to fragments of both promoters that contain these sequences

Nole-Wilson S, Krizek BA - AINTEGUMENTA contributes to organ polarity and regulates growth of lateral organs in combination with YABBY genes

• DNA-protein Interaction

Chromatin immunoprecipitation (ChIP) assay revealed that SKB1 antibody could specifically pull down the FLC promoter (region A) (Figure 5B), a chromatin region that is critical for FLC transcription

Wang X, Zhang Y, Ma Q, Zhang Z, Xue Y, Bao S, Chong K - SKB1-mediated symmetric dimethylation of histone H4R3 controls flowering time in Arabidopsis

• DNA-protein Interaction

To test this directly, we used a chromatin immunoprecipitation (ChIP) assay to determine the association of AtOFP1 protein with the cis-acting regulatory sequence of AtGA20ox1. We used 35S:HA-AtOFP1 plants for our ChIP assay, because we have shown that the HA–AtOFP1 fusion protein is functional (Figure 3). Furthermore, the presence of the HA tag in the HA–AtOFP1 fusion protein allowed us to immunoprecipitate the HA–AtOFP1 fusion protein using anti-HA antibodies. The specificity of the HA antibodies has been tested (Figure 3e). By using anti-HA antibodies for ChIP, we detected a specific PCR product of the expected size amplified using primers specific to the promoter region or the first intron of AtGA20ox1 (Figure 7a). These regions have been previously shown to be the binding sites for KNOX proteins (Chen et al., 2004; Sakamoto et al., 2001). We used anti-H3-K9 Ac antibodies to monitor our ChIP assays. As expected, a PCR product specific to the ARPN gene (At2g02850) was amplified (Figure 7b), consistent with previous findings by Tian et al. (2005). As a mock control, we used rabbit pre-immune sera, and did not detect any specific PCR products using the same sets of primers (Figure 7). Therefore, we conclude that AtGA20ox1 is indeed a direct target gene of AtOFP1

Wang S, Chang Y, Guo J, Chen JG - Arabidopsis Ovate Family Protein 1 is a transcriptional repressor that suppresses cell elongation

• DNA-protein Interaction

Consistent with this, surface plasmon resonance experiments demonstrated that the prokaryotically overexpressed His:S:BIN4 protein strongly binds DNA in a concentration- and salt-dependent manner

Breuer C, Stacey NJ, West CE, Zhao Y, Chory J, Tsukaya H, Azumi Y, Maxwell A, Roberts K, Sugimoto-Shirasu K - BIN4, a novel component of the plant DNA topoisomerase VI complex, is required for endoreduplication in Arabidopsis

• DNA-protein Interaction

BES1 binding to the promoter of SAUR-15

Vert G, Walcher CL, Chory J, Nemhauser JL - Integration of auxin and brassinosteroid pathways by Auxin Response Factor 2

• DNA-protein Interaction

ARF2 could bind to the SAUR-15 promoter, and preincubation with BIN2 greatly reduced DNA binding activity

Vert G, Walcher CL, Chory J, Nemhauser JL - Integration of auxin and brassinosteroid pathways by Auxin Response Factor 2

• DNA-protein Interaction

Using double-stranded oligonucleotides covering the potential TCP binding sites in the context of the LOX2 promoter, we performed EMSAs. The in vitro studies confirmed that TCP4 can bind strongly to at least two of the consensus motifs

Schommer C, Palatnik JF, Aggarwal P, Chételat A, Cubas P, Farmer EE, Nath U, Weigel D - Control of jasmonate biosynthesis and senescence by miR319 targets

• DNA-protein Interaction

In parallel, we identified the preferred binding site of TCP4 by in vitro selection [63]. Of 27 clones obtained after ten rounds of selection, 25 contained a variant of the consensus motif gGGaCCAC, which includes as a core the GGACCA motif found in the promoters of TCP-response genes

Schommer C, Palatnik JF, Aggarwal P, Chételat A, Cubas P, Farmer EE, Nath U, Weigel D - Control of jasmonate biosynthesis and senescence by miR319 targets

• DNA-protein Interaction

In EMSA performed with the TCP consensus motif of AtCDT1a (ATGGGCCT, −215 to −223) and its homologue AtCDT1b (ATGGGCCC, position −129 to −137), both AtTCP24 and AtTCP24–ABAP1 were associated with the wild type (Figure 4C, lanes 1, 5, 10 and 14) but not with the mutated probes (Figure 4C, lanes 4, 9, 13 and 18). ABAP1 alone was associated with neither of the probes (Figure 4C, lanes 6 and 15). The presence of AtTCP24–GST and ABAP1 in the protein–DNA complex was confirmed by a supershift assay with anti-ABAP1 and anti-GST antibodies

Masuda HP, Cabral LM, De Veylder L, Tanurdzic M, de Almeida Engler J, Geelen D, Inzé D, Martienssen RA, Ferreira PC, Hemerly AS - ABAP1 is a novel plant Armadillo BTB protein involved in DNA replication and transcription

• DNA-protein Interaction

In EMSA performed with the TCP consensus motif of AtCDT1a (ATGGGCCT, −215 to −223) and its homologue AtCDT1b (ATGGGCCC, position −129 to −137), both AtTCP24 and AtTCP24–ABAP1 were associated with the wild type (Figure 4C, lanes 1, 5, 10 and 14) but not with the mutated probes (Figure 4C, lanes 4, 9, 13 and 18). ABAP1 alone was associated with neither of the probes (Figure 4C, lanes 6 and 15). The presence of AtTCP24–GST and ABAP1 in the protein–DNA complex was confirmed by a supershift assay with anti-ABAP1 and anti-GST antibodies

Masuda HP, Cabral LM, De Veylder L, Tanurdzic M, de Almeida Engler J, Geelen D, Inzé D, Martienssen RA, Ferreira PC, Hemerly AS - ABAP1 is a novel plant Armadillo BTB protein involved in DNA replication and transcription

• DNA-protein Interaction

In EMSA performed with the TCP consensus motif of AtCDT1a (ATGGGCCT, −215 to −223) and its homologue AtCDT1b (ATGGGCCC, position −129 to −137), both AtTCP24 and AtTCP24–ABAP1 were associated with the wild type (Figure 4C, lanes 1, 5, 10 and 14) but not with the mutated probes (Figure 4C, lanes 4, 9, 13 and 18). ABAP1 alone was associated with neither of the probes (Figure 4C, lanes 6 and 15). The presence of AtTCP24–GST and ABAP1 in the protein–DNA complex was confirmed by a supershift assay with anti-ABAP1 and anti-GST antibodies

Masuda HP, Cabral LM, De Veylder L, Tanurdzic M, de Almeida Engler J, Geelen D, Inzé D, Martienssen RA, Ferreira PC, Hemerly AS - ABAP1 is a novel plant Armadillo BTB protein involved in DNA replication and transcription

• DNA-protein Interaction

The ability of the ABAP1–AtTCP24 heterodimer to recognize the consensus sequence for class-II TCP (TGGGCC/T) (Trémousaygue et al, 2003) was confirmed in electrophoretic mobility shift assays (EMSAs)

Masuda HP, Cabral LM, De Veylder L, Tanurdzic M, de Almeida Engler J, Geelen D, Inzé D, Martienssen RA, Ferreira PC, Hemerly AS - ABAP1 is a novel plant Armadillo BTB protein involved in DNA replication and transcription

• DNA-protein Interaction

To test this hypothesis, we first confirmed that ABAP1 associates with AtCDT1 promoters in vivo in chromatin immunoprecipitation (ChIP) experiments with anti-ABAP1 antibody (Figure 4F). The results revealed that ABAP1 was associated with regions of the AtCDT1a ... promoters harbouring the TCP consensus motif. This interaction was site-specific as ABAP1 was not detected in a 350-bp region inside the AtCDT1a-coding region

Masuda HP, Cabral LM, De Veylder L, Tanurdzic M, de Almeida Engler J, Geelen D, Inzé D, Martienssen RA, Ferreira PC, Hemerly AS - ABAP1 is a novel plant Armadillo BTB protein involved in DNA replication and transcription

• DNA-protein Interaction

In EMSA performed with the TCP consensus motif of AtCDT1a (ATGGGCCT, −215 to −223) and its homologue AtCDT1b (ATGGGCCC, position −129 to −137), both AtTCP24 and AtTCP24–ABAP1 were associated with the wild type (Figure 4C, lanes 1, 5, 10 and 14) but not with the mutated probes (Figure 4C, lanes 4, 9, 13 and 18). ABAP1 alone was associated with neither of the probes (Figure 4C, lanes 6 and 15). The presence of AtTCP24–GST and ABAP1 in the protein–DNA complex was confirmed by a supershift assay with anti-ABAP1 and anti-GST antibodies

Masuda HP, Cabral LM, De Veylder L, Tanurdzic M, de Almeida Engler J, Geelen D, Inzé D, Martienssen RA, Ferreira PC, Hemerly AS - ABAP1 is a novel plant Armadillo BTB protein involved in DNA replication and transcription

• DNA-protein Interaction

To test this hypothesis, we first confirmed that ABAP1 associates with AtCDT1 promoters in vivo in chromatin immunoprecipitation (ChIP) experiments with anti-ABAP1 antibody (Figure 4F). The results revealed that ABAP1 was associated with regions of the ... AtCDT1b promoters harbouring the TCP consensus motif

Masuda HP, Cabral LM, De Veylder L, Tanurdzic M, de Almeida Engler J, Geelen D, Inzé D, Martienssen RA, Ferreira PC, Hemerly AS - ABAP1 is a novel plant Armadillo BTB protein involved in DNA replication and transcription

• DNA-protein Interaction

The ability of the ABAP1–AtTCP24 heterodimer to recognize the consensus sequence for class-II TCP (TGGGCC/T) (Trémousaygue et al, 2003) was confirmed in electrophoretic mobility shift assays (EMSAs)

Masuda HP, Cabral LM, De Veylder L, Tanurdzic M, de Almeida Engler J, Geelen D, Inzé D, Martienssen RA, Ferreira PC, Hemerly AS - ABAP1 is a novel plant Armadillo BTB protein involved in DNA replication and transcription

• DNA-protein Interaction

To determine whether KAN1 binds directly to the AS2 promoter we examined the chromatin fragments that immunoprecipitate with KAN1-GR in DEX- and mock-treated 35S:KAN1-GR seedlings. A 300-bp region surrounding the site of as2–5D mutation and two adjacent 300-bp regions upstream of the translation start site were amplified by PCR from immunoprecipitated material. KAN1 binding (as judged by enrichment after chromatin immunoprecipitation) was detected only for the fragment containing the as2–5D mutation (Fig. 4B). No enrichment was observed in 35S:KAN1-GR plants homozygous for as2–5D, demonstrating that the as2–5D mutation prevents or greatly reduces the binding of KAN1 to this site ... These results indicate that AS2 is directly repressed by KAN1 via the site that is mutated in as2–5D

Wu G, Lin WC, Huang T, Poethig RS, Springer PS, Kerstetter RA - KANADI1 regulates adaxial-abaxial polarity in Arabidopsis by directly repressing the transcription of ASYMMETRIC LEAVES2

• DNA-protein Interaction

Using antibodies against SSRP1 and SPT16, we used chromatin immunoprecipitation to examine the association of FACT with the chromatin spanning the FLC locus (Figure 6a). The precipitated genomic DNA was monitored by quantitative real-time PCR relative to the input chromatin. Compared to Col-0, association of the FACT subunits is reduced in three regions of FLC, and the reduction is more prominent with ssrp1-2 than with spt16-1 (Figure 6b,c). In addition to FLC, we analysed the association of FACT with two housekeeping genes, Actin8 and Ubq5, whose expression according to quantitative real-time RT-PCR was not altered in ssrp1-2 and spt16-1 (data not shown). Association with the FACT subunits is also reduced at these loci (Figure 6b,c), suggesting that FLC is more sensitive to reduced levels of FACT

Lolas IB, Himanen K, Grønlund JT, Lynggaard C, Houben A, Melzer M, Van Lijsebettens M, Grasser KD - The transcript elongation factor FACT affects Arabidopsis vegetative and reproductive development and genetically interacts with HUB1/2

• DNA-protein Interaction

Using antibodies against SSRP1 and SPT16, we used chromatin immunoprecipitation to examine the association of FACT with the chromatin spanning the FLC locus (Figure 6a). The precipitated genomic DNA was monitored by quantitative real-time PCR relative to the input chromatin. Compared to Col-0, association of the FACT subunits is reduced in three regions of FLC, and the reduction is more prominent with ssrp1-2 than with spt16-1 (Figure 6b,c). In addition to FLC, we analysed the association of FACT with two housekeeping genes, Actin8 and Ubq5, whose expression according to quantitative real-time RT-PCR was not altered in ssrp1-2 and spt16-1 (data not shown). Association with the FACT subunits is also reduced at these loci (Figure 6b,c), suggesting that FLC is more sensitive to reduced levels of FACT

Lolas IB, Himanen K, Grønlund JT, Lynggaard C, Houben A, Melzer M, Van Lijsebettens M, Grasser KD - The transcript elongation factor FACT affects Arabidopsis vegetative and reproductive development and genetically interacts with HUB1/2

• DNA-protein Interaction

To determine whether BOP1 directly associates with AS2 regulatory sequences, we performed chromatin immunoprecipitation (ChIP) using BOP1-GR bop1-1 transgenic plants. After determining that full-length BOP1-GR fusion protein in the nuclear fraction was specifically recognized by an anti-GR antibody (see Supplemental Figure 2 online), we performed ChIP assays using 11 sets of primers spanning 5 kb of the AS2 upstream genomic sequence and coding region. Compared with the input and mock control, Dex-treated BOP1-GR bop1-1 samples showed strong enrichment at sites IV, V, and VI in the promoter region (Figures 4A and 4B). Using quantitative PCR, we detected 25-fold enrichment of site V after Dex treatment (Figure 4A). ChIP assays performed on untransformed bop1-1 plants showed no significant enrichment of the promoter regions tested, nor did the control EF1 a and TUB4 genomic regions. These data demonstrate that BOP1 associates in vivo with specific regulatory sites located in the AS2 promoter ... the region between 2.6 and 3.2 kb upstream of the AS2 start site is required for the response of AS2 to BOP1 activation

Jun JH, Ha CM, Fletcher JC - BLADE-ON-PETIOLE1 coordinates organ determinacy and axial polarity in arabidopsis by directly activating ASYMMETRIC LEAVES2

• DNA-protein Interaction

The results from both in vitro and in vivo binding assays demonstrate that Dof5.1 directly binds to the REV promoter

Kim HS, Kim SJ, Abbasi N, Bressan RA, Yun DJ, Yoo SD, Kwon SY, Choi SB - The DOF transcription factor Dof5.1 influences leaf axial patterning by promoting Revoluta transcription in Arabidopsis

• DNA-protein Interaction

The EMSA result showed that, GST alone did not bind to the 89-bp long substrate (Figure 6d left, lane 2) but the GST–Dof5.1DB fusion protein migrated with promoter DNA

Kim HS, Kim SJ, Abbasi N, Bressan RA, Yun DJ, Yoo SD, Kwon SY, Choi SB - The DOF transcription factor Dof5.1 influences leaf axial patterning by promoting Revoluta transcription in Arabidopsis

• DNA-protein Interaction

In order to investigate the direct DNA–protein interaction between the XCP1 promoter sequence and the VND7 protein, we carried out electrophoretic mobility shift assay (EMSA). For EMSA, we prepared the poly-His-tagged N-terminal region of VND7 that includes the whole NAC domain (His-VND71-161) and the 138-bp XCP1 promoter fragment (from -233 to -96 bp), as we expected that it gives full XCP1 expression level in response to VND7, based on the transient reporter assay (Figure 4). When this fragment was labeled with biotin and incubated with the recombinant His-VND71-161 protein, we observed two gel-shift bands (Figure 5a). Because VND7 is expected to form homo- and/or heterodimers with VND family proteins, including VND7 (Yamaguchi et al., 2008), these two bands may correspond to the VND7 homodimer-DNA complex (upper band) and the VND7 monomer-DNA complex (lower band) (Figure 5a). Competitive binding experiments were performed with unlabeled XCP1 promoter fragments (from -233 to -96 bp), showing dose-dependent inhibition effects on the band shift. Notably, the upper band disappeared more rapidly than the lower band (Figure 5a). These results suggested that sensitivity to the competitive probes is a function of the nature of the protein-DNA complex, specifically the number of VND7 molecules present ... When the 138-bp XCP1 fragment was divided into two fragments, one of 53 bp (from -148 to -96 bp; X1E1) and the other of 85 bp (from -233 to -149 bp; X1E2), gel-shifted bands were also detected for both fragments (Figure 5b). Thus, the XCP1 promoter has at least two distinct binding sites for VND7. For both X1E1 and X1E2, no band was observed that corresponded to the VND7 homodimer-DNA complex present in the case of the 138-bp XCP1 promoter fragment (Figure 5b). These results led us to the additional conclusion that although VND7 can bind to two distinct regions of the XCP1 promoter, both regions are required in order to form the strict VND7 dimer–DNA complex

Yamaguchi M, Mitsuda N, Ohtani M, Ohme-Takagi M, Kato K, Demura T - VASCULAR-RELATED NAC-DOMAIN7 directly regulates the expression of a broad range of genes for xylem vessel formation

• DNA-protein Interaction

We subsequently performed EMSA on the promoters of the other candidates for VND7 direct target genes ... MYB83 (from -1000 to -498 bp ... shifted bands were observed ... These signals were significantly decreased by the application of competitive unlabeled fragments ... MYB83 should be considered direct targets of the VND7 protein

Yamaguchi M, Mitsuda N, Ohtani M, Ohme-Takagi M, Kato K, Demura T - VASCULAR-RELATED NAC-DOMAIN7 directly regulates the expression of a broad range of genes for xylem vessel formation

• DNA-protein Interaction

We subsequently performed EMSA on the promoters of the other candidates for VND7 direct target genes ... IRX5/CesA4 (from -367 to -71 bp ... shifted bands were observed ... These signals were significantly decreased by the application of competitive unlabeled fragments ... IRX5/CesA4 ... should be considered direct targets of the VND7 protein

Yamaguchi M, Mitsuda N, Ohtani M, Ohme-Takagi M, Kato K, Demura T - VASCULAR-RELATED NAC-DOMAIN7 directly regulates the expression of a broad range of genes for xylem vessel formation

• DNA-protein Interaction

We subsequently performed EMSA on the promoters of the other candidates for VND7 direct target genes: XCP2 (from -191 to -68 bp ... shifted bands were observed ... These signals were significantly decreased by the application of competitive unlabeled fragments ... XCP2 ... should be considered direct targets of the VND7 protein

Yamaguchi M, Mitsuda N, Ohtani M, Ohme-Takagi M, Kato K, Demura T - VASCULAR-RELATED NAC-DOMAIN7 directly regulates the expression of a broad range of genes for xylem vessel formation

• DNA-protein Interaction

We tested whether a recombinant STM protein could recognize the CUC1 promoter in vitro. Electrophoretic mobility shift assays (EMSAs) showed a strong and specific interaction between a promoter fragment and the STM homeodomain alone or the complete recombinant transcription factor (Fig. 4, B and C). Binding was competed by a 50-fold molar excess of the same unlabeled fragment but not by a similar amount of a different fragment, thus showing the specificity of the interaction (Supplemental Fig. S2). Mutating box1 caused a significant decrease in the binding efficiency and a further mutation in box2 almost completely abolished the interaction between the CUC1 promoter and STM in vitro

Spinelli SV, Martin AP, Viola IL, Gonzalez DH, Palatnik JF - A mechanistic link between STM and CUC1 during Arabidopsis development

• DNA-protein Interaction

We also analyzed the interaction between STM and the CUC1 promoter in a yeast (Saccharomyces cerevisiae) one-hybrid assay. STM directed CUC1 expression also in this system (Fig. 4D), expression which was lost when the putative binding box1 was mutated

Spinelli SV, Martin AP, Viola IL, Gonzalez DH, Palatnik JF - A mechanistic link between STM and CUC1 during Arabidopsis development

• DNA-protein Interaction

GTL1 protein directly interacts with the SDD1 promoter to repress its expression

Yoo CY, Hasegawa PM, Mickelbart MV - Regulation of stomatal density by the GTL1 transcription factor for improving water use efficiency

• DNA-protein Interaction

We then used the chromatin immunoprecipitation (ChIP) assay to test whether ARF2 could bind to the HB33 promoter in vivo. In this experiment, we used one transgenic line over-expressing ARF2-Flag (OE1) and the wild type as a negative control. Flag antibody was used for ChIP analysis. As shown in Figure 4B, ARF2-Flag bound to the HB33 promoter region

Wang L, Hua D, He J, Duan Y, Chen Z, Hong X, Gong Z - Auxin Response Factor2 (ARF2) and its regulated homeodomain gene HB33 mediate abscisic acid response in Arabidopsis

• DNA-protein Interaction

ARF2 ... bound to the promoter region of GH3.1

Wang L, Hua D, He J, Duan Y, Chen Z, Hong X, Gong Z - Auxin Response Factor2 (ARF2) and its regulated homeodomain gene HB33 mediate abscisic acid response in Arabidopsis

• DNA-protein Interaction

We expressed the GST fused with the DNA-binding domain in N-terminus (ARF2-N1-470) in Escherichia coli and purified the fused protein with the help of the GST tag ... ARF2 N-terminal DNA binding domain binds to AuxREs in the promoter of HB33

Wang L, Hua D, He J, Duan Y, Chen Z, Hong X, Gong Z - Auxin Response Factor2 (ARF2) and its regulated homeodomain gene HB33 mediate abscisic acid response in Arabidopsis

• DNA-protein Interaction

Finally, we tested if MYB3R4 binds directly to MSA motifs in vitro using the cycle amplification of targets (CASTing) method (Wright et al., 1991). The glutathione S-transferase (GST)-MYB3R4 fusion protein coupled to glutathione-Sepharose beads was incubated with random oligonucleotides, and the bound oligonucleotides were recovered and amplified by PCR. After this cycle had been repeated six times, the selected oligonucleotides were subcloned and sequenced. Motif-finding analysis with Weeder showed significant enrichment of the AACGG motif in 94 oligonucleotides obtained in the CASTing experiment (Supplemental Table S5). At least one AACGG motif was contained in 74 out of 94 sequences, among which 35 contained multiple such motifs. Figure 10 shows a sequence logo that was created using 39 sequences in which the AACGG motif occurred only once (as listed in Supplemental Fig. S3). The MYB3R4 recognition sequence in vitro was very similar, if not identical, to the consensus sequence of MSA motifs that occurred in promoters of G2/M-specific genes (Fig. 10; compare with Supplemental Fig. S2A). This suggest that MYB3R4, and possibly MYB3R1 as well, may bind directly to promoters of G2/M-specific genes by recognizing MSA motifs

Haga N, Kobayashi K, Suzuki T, Maeo K, Kubo M, Ohtani M, Mitsuda N, Demura T, Nakamura K, Jürgens G, Ito M - Mutations in MYB3R1 and MYB3R4 cause pleiotropic developmental defects and preferential down-regulation of multiple G2/M-specific genes in Arabidopsis

• DNA-protein Interaction

EMSA using a 362-bp fragment of the MYB32 promoter sequence including this binding motif clearly showed direct binding of SND1 to the fragment, but SND1m showed no binding

Wang H, Zhao Q, Chen F, Wang M, Dixon RA - NAC domain function and transcriptional control of a secondary cell wall master switch

• DNA-protein Interaction

The same promoter fragment of MYB46 as used for the trans-activation assay was then used in EMSAs for the direct demonstration of promoter binding. The direct binding of SND1 to this fragment was confirmed by adding unlabeled competitor DNA

Wang H, Zhao Q, Chen F, Wang M, Dixon RA - NAC domain function and transcriptional control of a secondary cell wall master switch

• DNA-protein Interaction

we investigated whether SND1 bound to its own promoter by EMSA analysis. The SND1 promoter sequences used for the dual luciferase assay spanned 1052 bp upstream of the start codon. For EMSA analysis, we cloned three overlapping promoter fragments by PCR, designated as P1, P2 and P3, encompassing this region of the 5′-upstream sequence (Figure 6c). Both P2 and P3 fragments showed a clear gel shift when incubated with SND1 that was abolished by adding a competitor DNA fragment. These results indicate that the SND1 protein can bind directly to its own promoter, and that there may be more than one binding site in the promoter sequence. The SND1 T95K mutant protein was unable to bind to the P2 fragment

Wang H, Zhao Q, Chen F, Wang M, Dixon RA - NAC domain function and transcriptional control of a secondary cell wall master switch

• DNA-protein Interaction

Since AS1 is a Myb transcription factor, we next analyzed a possible direct binding of AS1 to the FT promoter sequences in vitro. We detected specific binding of AS1 to the DNA fragment that corresponds to the amplicon 11 region in vitro (Figures 6b and S7a). Although we could not successfully identify specific cis-elements for AS1 binding, our competition experiments further narrowed down the AS1-binding region to the sequence positions of −371/−272 (Figure 6b). This suggests that the region probably contains an AS1-binding site. Based on Arabidopsis transient expression analysis, this region also participated in the CO-dependent induction of the FT:GUS reporter expression, although this region does not contain either the CCAAT-binding sites or the CORE (CO responsive element) sequences (Tiwari et al., 2010). Under our conditions, the presence of CO protein in the reaction did not affect the binding affinity of AS1 to the amplicon 11 sequences (Figure S7b), suggesting that CO may not be required for AS1 to bind the FT promoter. Together with our ChIP results, our data indicate that AS1 binds to the region around the transcriptional start site of FT in vivo

Song YH, Lee I, Lee SY, Imaizumi T, Hong JC - CONSTANS and ASYMMETRIC LEAVES 1 complex is involved in the induction of FLOWERING LOCUS T in photoperiodic flowering in Arabidopsis.

• DNA-protein Interaction

we examined whether AS1 also binds to the FT promoter. We performed chromatin immunoprecipitation (ChIP) analysis using plants expressing functional HA-tagged AS1 (Figures S3e and S6; previously described by Theodoris et al., 2003) and examined whether AS1–HA protein was co-immunoprecipitated with the FT chromatin (Figure 6a). The FT promoter sequences were most highly enriched around amplicons 8 and 11 in the 35S:AS1–HA line relative to the as1 mutant (Figure 6a). These contain the regions that CO proteins may associate with the FT promoter (Adrian et al., 2010; Tiwari et al., 2010). Our ChIP results indicate a presence of AS1 in the regions adjacent to a transcriptional start site of FT

Song YH, Lee I, Lee SY, Imaizumi T, Hong JC - CONSTANS and ASYMMETRIC LEAVES 1 complex is involved in the induction of FLOWERING LOCUS T in photoperiodic flowering in Arabidopsis.

• DNA-protein Interaction

ChIP analyses revealed that PCNA was highly accumulated in most of the examined chromatin regions in the elo3 and fas1-4 mutants

Xu D, Huang W, Li Y, Wang H, Huang H, Cui X - Elongator complex is critical for cell cycle progression and leaf patterning in Arabidopsis

• DNA-protein Interaction

As PCNA is a key player in DNA replication and repair, we further tested whether Elongator is associated with the chromatin regions within replicons by chromatin immunoprecipitation (ChIP) assays ... As shown in Figure 7c,d, DRL1-YFP and Flag-ELO1 were clearly enriched within both the early and late replicons. ChIP analysis also revealed that PCNA associates with these chromatin regions (Figure 7e,f). Given that Elongator and PCNA form a protein complex in planta, these results indicated that they may associate together with replicons during DNA replication

Xu D, Huang W, Li Y, Wang H, Huang H, Cui X - Elongator complex is critical for cell cycle progression and leaf patterning in Arabidopsis

• DNA-protein Interaction

As PCNA is a key player in DNA replication and repair, we further tested whether Elongator is associated with the chromatin regions within replicons by chromatin immunoprecipitation (ChIP) assays ... As shown in Figure 7c,d, DRL1-YFP and Flag-ELO1 were clearly enriched within both the early and late replicons. ChIP analysis also revealed that PCNA associates with these chromatin regions (Figure 7e,f). Given that Elongator and PCNA form a protein complex in planta, these results indicated that they may associate together with replicons during DNA replication

Xu D, Huang W, Li Y, Wang H, Huang H, Cui X - Elongator complex is critical for cell cycle progression and leaf patterning in Arabidopsis

• DNA-protein Interaction

ChIP analyses revealed that PCNA was highly accumulated in most of the examined chromatin regions in the elo3 and fas1-4 mutants

Xu D, Huang W, Li Y, Wang H, Huang H, Cui X - Elongator complex is critical for cell cycle progression and leaf patterning in Arabidopsis

• DNA-protein Interaction

As PCNA is a key player in DNA replication and repair, we further tested whether Elongator is associated with the chromatin regions within replicons by chromatin immunoprecipitation (ChIP) assays ... As shown in Figure 7c,d, DRL1-YFP and Flag-ELO1 were clearly enriched within both the early and late replicons. ChIP analysis also revealed that PCNA associates with these chromatin regions (Figure 7e,f). Given that Elongator and PCNA form a protein complex in planta, these results indicated that they may associate together with replicons during DNA replication

Xu D, Huang W, Li Y, Wang H, Huang H, Cui X - Elongator complex is critical for cell cycle progression and leaf patterning in Arabidopsis

• DNA-protein Interaction

As PCNA is a key player in DNA replication and repair, we further tested whether Elongator is associated with the chromatin regions within replicons by chromatin immunoprecipitation (ChIP) assays ... As shown in Figure 7c,d, DRL1-YFP and Flag-ELO1 were clearly enriched within both the early and late replicons. ChIP analysis also revealed that PCNA associates with these chromatin regions (Figure 7e,f). Given that Elongator and PCNA form a protein complex in planta, these results indicated that they may associate together with replicons during DNA replication

Xu D, Huang W, Li Y, Wang H, Huang H, Cui X - Elongator complex is critical for cell cycle progression and leaf patterning in Arabidopsis

• DNA-protein Interaction

We performed ChIP-quantitative PCR using antibodies against LFY in pedicels of DEX-treated 35S:LFY-GR plants (Wagner et al., 1999). We detected strong occupancy of LFY at region B, which contains a primary LFY binding motif and two secondary motifs (Figure 6k). We also detected weak binding of LFY at region C, which contains four secondary motifs (Figure 6l). However, enrichment of LFY was not observed in regions A and D–F on AS2, suggesting that the binding of LFY at regions B and C is specific (Figure 6k,l). Ectopic LFY activity in pedicels may thus directly regulate AS2 transcription

Yamaguchi N, Yamaguchi A, Abe M, Wagner D, Komeda Y - LEAFY controls Arabidopsis pedicel length and orientation by affecting adaxial-abaxial cell fate

• DNA-protein Interaction

AtrbohE ... We used chromatin immunoprecipitation (ChIP) assays using 35S:MYC-4ΔC transgenic plants to investigate whether NTL4 binds to the sequence motifs. Quantitative ChIP/PCR assays using an anti-MYC antibody revealed that the 4ΔC protein binds efficiently to the conserved sequence motifs in the Atrboh gene promoters (Figure 7b). In addition, binding of the 4ΔC protein to the promoter elements was further increased after exposure to drought conditions

Lee S, Seo PJ, Lee HJ, Park CM - Accelerated cell death 2 suppresses mitochondrial oxidative bursts and modulates cell death in Arabidopsis

• DNA-protein Interaction

AtrbohC ... We used chromatin immunoprecipitation (ChIP) assays using 35S:MYC-4ΔC transgenic plants to investigate whether NTL4 binds to the sequence motifs. Quantitative ChIP/PCR assays using an anti-MYC antibody revealed that the 4ΔC protein binds efficiently to the conserved sequence motifs in the Atrboh gene promoters (Figure 7b). In addition, binding of the 4ΔC protein to the promoter elements was further increased after exposure to drought conditions

Lee S, Seo PJ, Lee HJ, Park CM - Accelerated cell death 2 suppresses mitochondrial oxidative bursts and modulates cell death in Arabidopsis

• DNA-protein Interaction

We next investigated whether TCP2, TCP3 and TCP10 bind to the promoters of BP and KNAT2 by ChIP, using transgenic plants expressing TCP2-YFP, TCP3-YFP or TCP10-YFP under the estrogen-inducible promoter (Zuo et al., 2000) and the anti-GFP antibody ... TCP3-YFP ... bound regions 3 and 6 of the BP promoter

Li Z, Li B, Shen WH, Huang H, Dong A - TCP transcription factors interact with AS2 in the repression of class-I KNOX genes in Arabidopsis thaliana

• DNA-protein Interaction

We next investigated whether TCP2, TCP3 and TCP10 bind to the promoters of BP and KNAT2 by ChIP, using transgenic plants expressing TCP2-YFP, TCP3-YFP or TCP10-YFP under the estrogen-inducible promoter (Zuo et al., 2000) and the anti-GFP antibody ... TCP2-YFP only showed significant binding at region 3 of the KNAT2 promoter

Li Z, Li B, Shen WH, Huang H, Dong A - TCP transcription factors interact with AS2 in the repression of class-I KNOX genes in Arabidopsis thaliana

• DNA-protein Interaction

Our ChIP data showed that AS2 bound to the promoters of ... KNAT2 at distinct regions 3 and 6

Li Z, Li B, Shen WH, Huang H, Dong A - TCP transcription factors interact with AS2 in the repression of class-I KNOX genes in Arabidopsis thaliana

• DNA-protein Interaction

We next investigated whether TCP2, TCP3 and TCP10 bind to the promoters of BP and KNAT2 by ChIP, using transgenic plants expressing TCP2-YFP, TCP3-YFP or TCP10-YFP under the estrogen-inducible promoter ... TCP10-YFP bound regions 3 and 6 of the BP promoter

Li Z, Li B, Shen WH, Huang H, Dong A - TCP transcription factors interact with AS2 in the repression of class-I KNOX genes in Arabidopsis thaliana

• DNA-protein Interaction

We next investigated whether TCP2, TCP3 and TCP10 bind to the promoters of BP and KNAT2 by ChIP, using transgenic plants expressing TCP2-YFP, TCP3-YFP or TCP10-YFP under the estrogen-inducible promoter (Zuo et al., 2000) and the anti-GFP antibody ... TCP10-YFP bound ... region 3 of the KNAT2 promoter

Li Z, Li B, Shen WH, Huang H, Dong A - TCP transcription factors interact with AS2 in the repression of class-I KNOX genes in Arabidopsis thaliana

• DNA-protein Interaction

Our ChIP data showed that AS2 bound to the promoters of BP ... at distinct regions 3 and 6

Li Z, Li B, Shen WH, Huang H, Dong A - TCP transcription factors interact with AS2 in the repression of class-I KNOX genes in Arabidopsis thaliana

• DNA-protein Interaction

We next investigated whether TCP2, TCP3 and TCP10 bind to the promoters of BP and KNAT2 by ChIP, using transgenic plants expressing TCP2-YFP, TCP3-YFP or TCP10-YFP under the estrogen-inducible promoter (Zuo et al., 2000) and the anti-GFP antibody. Both TCP3-YFP ... bound ... region 3 of the KNAT2 promoter

Li Z, Li B, Shen WH, Huang H, Dong A - TCP transcription factors interact with AS2 in the repression of class-I KNOX genes in Arabidopsis thaliana

• DNA-protein Interaction

A ChIP experiment was performed to determine whether YUC10 is a direct target of the LEC1 protein. As assayed by quantitative RT-PCR, LEC1-bound YUC10 DNA fragments were significantly (P < 0.01) enriched after DEX treatment in comparison with the ethanol-treated control sample (Figure 5d). In contrast to ABA-dependent activation of YUC10 expression, binding of LEC1 to the YUC10 promoter was independent of the presence of exogenous ABA

Junker A, Mönke G, Rutten T, Keilwagen J, Seifert M, Thi TM, Renou JP, Balzergue S, Viehöver P, Hähnel U, Ludwig-Müller J, Altschmied L, Conrad U, Weisshaar B, Bäumlein H - Elongation-related functions of LEAFY COTYLEDON1 during the development of Arabidopsis thaliana

• DNA-protein Interaction

ChIP analyses did not detect the binding of RGA-6HA to the STU locus

Lee LY, Hou X, Fang L, Fan S, Kumar PP, Yu H - STUNTED mediates the control of cell proliferation by GA in Arabidopsis

• DNA-protein Interaction

PIF4-HA also bound to the promoter of all tested genes ... FHL

Hornitschek P, Kohnen MV, Lorrain S, Rougemont J, Ljung K, López-Vidriero I, Franco-Zorrilla JM, Solano R, Trevisan M, Pradervand S, Xenarios I, Fankhauser C - Phytochrome interacting factors 4 and 5 control seedling growth in changing light conditions by directly controlling auxin signaling

• DNA-protein Interaction

We conducted ChIP experiments in order to determine whether these genes were bound by ... PIF5 in low PAR ... Binding ... was also observed in the promoter of the shade marker genes PIL1

Hornitschek P, Kohnen MV, Lorrain S, Rougemont J, Ljung K, López-Vidriero I, Franco-Zorrilla JM, Solano R, Trevisan M, Pradervand S, Xenarios I, Fankhauser C - Phytochrome interacting factors 4 and 5 control seedling growth in changing light conditions by directly controlling auxin signaling

• DNA-protein Interaction

PIF4-HA also bound to the promoter of all tested genes ... IAA29

Hornitschek P, Kohnen MV, Lorrain S, Rougemont J, Ljung K, López-Vidriero I, Franco-Zorrilla JM, Solano R, Trevisan M, Pradervand S, Xenarios I, Fankhauser C - Phytochrome interacting factors 4 and 5 control seedling growth in changing light conditions by directly controlling auxin signaling

• DNA-protein Interaction

PIF4-HA also bound to the promoter of all tested genes ... CKX5

Hornitschek P, Kohnen MV, Lorrain S, Rougemont J, Ljung K, López-Vidriero I, Franco-Zorrilla JM, Solano R, Trevisan M, Pradervand S, Xenarios I, Fankhauser C - Phytochrome interacting factors 4 and 5 control seedling growth in changing light conditions by directly controlling auxin signaling

• DNA-protein Interaction

PIF4-HA also bound to the promoter of all tested genes ... YUC8

Hornitschek P, Kohnen MV, Lorrain S, Rougemont J, Ljung K, López-Vidriero I, Franco-Zorrilla JM, Solano R, Trevisan M, Pradervand S, Xenarios I, Fankhauser C - Phytochrome interacting factors 4 and 5 control seedling growth in changing light conditions by directly controlling auxin signaling

• DNA-protein Interaction

We conducted ChIP experiments in order to determine whether these genes were bound by PIF4 ... in low PAR. PIF4-HA ... are bound to the promoters of genes involved in auxin biosynthesis and signaling ... IAA29

Hornitschek P, Kohnen MV, Lorrain S, Rougemont J, Ljung K, López-Vidriero I, Franco-Zorrilla JM, Solano R, Trevisan M, Pradervand S, Xenarios I, Fankhauser C - Phytochrome interacting factors 4 and 5 control seedling growth in changing light conditions by directly controlling auxin signaling

• DNA-protein Interaction

We conducted ChIP experiments in order to determine whether these genes were bound by ... PIF5 in low PAR ... PIF5-HA ... bound to the promoters of genes involved in auxin biosynthesis and signaling ... YUC8

Hornitschek P, Kohnen MV, Lorrain S, Rougemont J, Ljung K, López-Vidriero I, Franco-Zorrilla JM, Solano R, Trevisan M, Pradervand S, Xenarios I, Fankhauser C - Phytochrome interacting factors 4 and 5 control seedling growth in changing light conditions by directly controlling auxin signaling

• DNA-protein Interaction

We conducted ChIP experiments in order to determine whether these genes were bound by PIF4 ... in low PAR ... Binding ... was also observed in the promoter of the shade marker genes ... HFR1

Hornitschek P, Kohnen MV, Lorrain S, Rougemont J, Ljung K, López-Vidriero I, Franco-Zorrilla JM, Solano R, Trevisan M, Pradervand S, Xenarios I, Fankhauser C - Phytochrome interacting factors 4 and 5 control seedling growth in changing light conditions by directly controlling auxin signaling

• DNA-protein Interaction

We conducted ChIP experiments in order to determine whether these genes were bound by ... PIF5 in low PAR ... PIF5-HA ... bound to the promoters of genes involved in auxin biosynthesis and signaling ... IAA29

Hornitschek P, Kohnen MV, Lorrain S, Rougemont J, Ljung K, López-Vidriero I, Franco-Zorrilla JM, Solano R, Trevisan M, Pradervand S, Xenarios I, Fankhauser C - Phytochrome interacting factors 4 and 5 control seedling growth in changing light conditions by directly controlling auxin signaling

• DNA-protein Interaction

We conducted ChIP experiments in order to determine whether these genes were bound by PIF4 ... in low PAR. PIF4-HA ... bound to the promoters of genes involved in auxin biosynthesis and signaling ... YUC8

Hornitschek P, Kohnen MV, Lorrain S, Rougemont J, Ljung K, López-Vidriero I, Franco-Zorrilla JM, Solano R, Trevisan M, Pradervand S, Xenarios I, Fankhauser C - Phytochrome interacting factors 4 and 5 control seedling growth in changing light conditions by directly controlling auxin signaling

• DNA-protein Interaction

We conducted ChIP experiments in order to determine whether these genes were bound by PIF4 ... in low PAR ... Binding ... was also observed in the promoter of the shade marker genes PIL1

Hornitschek P, Kohnen MV, Lorrain S, Rougemont J, Ljung K, López-Vidriero I, Franco-Zorrilla JM, Solano R, Trevisan M, Pradervand S, Xenarios I, Fankhauser C - Phytochrome interacting factors 4 and 5 control seedling growth in changing light conditions by directly controlling auxin signaling

• DNA-protein Interaction

In order to obtain a global view of the importance of PIF5 during shade avoidance we performed a ChIP experiment followed by ultrahigh throughput sequencing (ChIP-seq) using a PIF5-HA line that was subjected to a 2 h low R/FR treatment (Lorrain et al., 2008). We generated DNA libraries, one for the chromatin (input) and one for the enriched chromatin fragments following immunoprecipitation (IP). In total, 1103 PIF5 binding sites were detected using Model-based Analysis of ChIP Sequ (MACS) (Zhang et al., 2008). For further analysis we considered peaks located in the proximity of genes defined as follows: from –3000 bp of the transcript to 500 bp downstream of the transcript. This list comprises 962 peaks and identifies 1218 Arabidopsis Genome Initiative loci (Table S1). As an example the reads located on three closely spaced G-boxes present 5′ of the PIL1 gene are presented

Hornitschek P, Kohnen MV, Lorrain S, Rougemont J, Ljung K, López-Vidriero I, Franco-Zorrilla JM, Solano R, Trevisan M, Pradervand S, Xenarios I, Fankhauser C - Phytochrome interacting factors 4 and 5 control seedling growth in changing light conditions by directly controlling auxin signaling

• DNA-protein Interaction

We conducted ChIP experiments in order to determine whether these genes were bound by ... PIF5 in low PAR ... Binding ... was also observed in the promoter of the shade marker genes ... HFR1

Hornitschek P, Kohnen MV, Lorrain S, Rougemont J, Ljung K, López-Vidriero I, Franco-Zorrilla JM, Solano R, Trevisan M, Pradervand S, Xenarios I, Fankhauser C - Phytochrome interacting factors 4 and 5 control seedling growth in changing light conditions by directly controlling auxin signaling

• DNA-protein Interaction

REV as a direct upstream regulator of ... HAT3

Brandt R, Salla-Martret M, Bou-Torrent J, Musielak T, Stahl M, Lanz C, Ott F, Schmid M, Greb T, Schwarz M, Choi SB, Barton MK, Reinhart BJ, Liu T, Quint M, Palauqui JC, Martínez-García JF, Wenkel S - Genome-wide binding-site analysis of REVOLUTA reveals a link between leaf patterning and light-mediated growth responses

• DNA-protein Interaction

Genome-wide identification of REVOLUTA target genes ... Both ChIP-Seq experiments also identified TAA1 as a putative direct target gene. While the first ChIP-Seq experiment revealed a binding site in the 3′ region of TAA1, the second ChIP-Seq study revealed binding in the 5′ region

Brandt R, Salla-Martret M, Bou-Torrent J, Musielak T, Stahl M, Lanz C, Ott F, Schmid M, Greb T, Schwarz M, Choi SB, Barton MK, Reinhart BJ, Liu T, Quint M, Palauqui JC, Martínez-García JF, Wenkel S - Genome-wide binding-site analysis of REVOLUTA reveals a link between leaf patterning and light-mediated growth responses

• DNA-protein Interaction

This direct regulation was again confirmed by qChIP-PCRs and we detected binding of REV to the 5′ promoter of ... TAA1

Brandt R, Salla-Martret M, Bou-Torrent J, Musielak T, Stahl M, Lanz C, Ott F, Schmid M, Greb T, Schwarz M, Choi SB, Barton MK, Reinhart BJ, Liu T, Quint M, Palauqui JC, Martínez-García JF, Wenkel S - Genome-wide binding-site analysis of REVOLUTA reveals a link between leaf patterning and light-mediated growth responses

• DNA-protein Interaction

This direct regulation was again confirmed by qChIP-PCRs and we detected binding of REV to the 5′ promoter of ... YUC5

Brandt R, Salla-Martret M, Bou-Torrent J, Musielak T, Stahl M, Lanz C, Ott F, Schmid M, Greb T, Schwarz M, Choi SB, Barton MK, Reinhart BJ, Liu T, Quint M, Palauqui JC, Martínez-García JF, Wenkel S - Genome-wide binding-site analysis of REVOLUTA reveals a link between leaf patterning and light-mediated growth responses

• DNA-protein Interaction

In the TAA1 promoter, binding of KAN1 is more complex and we identified two regions of potential KAN1 binding. The first region is about 3.0 kb upstream, whereas the second region is located in the second intron

Brandt R, Salla-Martret M, Bou-Torrent J, Musielak T, Stahl M, Lanz C, Ott F, Schmid M, Greb T, Schwarz M, Choi SB, Barton MK, Reinhart BJ, Liu T, Quint M, Palauqui JC, Martínez-García JF, Wenkel S - Genome-wide binding-site analysis of REVOLUTA reveals a link between leaf patterning and light-mediated growth responses

• DNA-protein Interaction

REV as a direct upstream regulator of ... HAT2

Brandt R, Salla-Martret M, Bou-Torrent J, Musielak T, Stahl M, Lanz C, Ott F, Schmid M, Greb T, Schwarz M, Choi SB, Barton MK, Reinhart BJ, Liu T, Quint M, Palauqui JC, Martínez-García JF, Wenkel S - Genome-wide binding-site analysis of REVOLUTA reveals a link between leaf patterning and light-mediated growth responses

• DNA-protein Interaction

To identify direct targets of REVOLUTA, an HD-ZIPIII protein, we used transgenic plants that expressed a FLAG-tagged ligand-binding domain of the glucocorticoid receptor, fused to a microRNA-resistant version of REV under control of the 35S-promoter (35S::FLAG-GR-REVd). We then used chromatin immunoprecipitation/DNA sequencing (ChIP-Seq) to monitor binding sites of the fusion protein in the A. thaliana genome. Comparative analysis of two biologically independent ChIP-Seq experiments revealed regions that showed enrichment in both datasets (Figure 1a,b and Data S1). Among the identified putative targets is also the LITTLE ZIPPER (ZPR) gene ZPR1, which is known to be regulated by REV (Wenkel et al., 2007), which supported the validity of our screen

Brandt R, Salla-Martret M, Bou-Torrent J, Musielak T, Stahl M, Lanz C, Ott F, Schmid M, Greb T, Schwarz M, Choi SB, Barton MK, Reinhart BJ, Liu T, Quint M, Palauqui JC, Martínez-García JF, Wenkel S - Genome-wide binding-site analysis of REVOLUTA reveals a link between leaf patterning and light-mediated growth responses

• DNA-protein Interaction

REV as a direct upstream regulator of ... TAA1

Brandt R, Salla-Martret M, Bou-Torrent J, Musielak T, Stahl M, Lanz C, Ott F, Schmid M, Greb T, Schwarz M, Choi SB, Barton MK, Reinhart BJ, Liu T, Quint M, Palauqui JC, Martínez-García JF, Wenkel S - Genome-wide binding-site analysis of REVOLUTA reveals a link between leaf patterning and light-mediated growth responses

• DNA-protein Interaction

Using chromatin immunoprecipitation, we tried to identify regions of KAN1 binding in the promoters ... Strong binding was observed in the HAT2 promoter, where KAN1 interacts with a region about 1.0 kb upstream of the transcriptional start site

Brandt R, Salla-Martret M, Bou-Torrent J, Musielak T, Stahl M, Lanz C, Ott F, Schmid M, Greb T, Schwarz M, Choi SB, Barton MK, Reinhart BJ, Liu T, Quint M, Palauqui JC, Martínez-García JF, Wenkel S - Genome-wide binding-site analysis of REVOLUTA reveals a link between leaf patterning and light-mediated growth responses

• DNA-protein Interaction

REV as a direct upstream regulator of ... ATHB4

Brandt R, Salla-Martret M, Bou-Torrent J, Musielak T, Stahl M, Lanz C, Ott F, Schmid M, Greb T, Schwarz M, Choi SB, Barton MK, Reinhart BJ, Liu T, Quint M, Palauqui JC, Martínez-García JF, Wenkel S - Genome-wide binding-site analysis of REVOLUTA reveals a link between leaf patterning and light-mediated growth responses

• DNA-protein Interaction

As shown for the published 35S::KAN1-GR plants, our 35S::FLAG-GR-KAN1 line was also able to strongly repress expression of the ASYMMETRIC LEAVES2 gene (Figure S3) and we were also able to detect binding of the chimeric FLAG-GR-KAN1 protein close to the first exon

Brandt R, Salla-Martret M, Bou-Torrent J, Musielak T, Stahl M, Lanz C, Ott F, Schmid M, Greb T, Schwarz M, Choi SB, Barton MK, Reinhart BJ, Liu T, Quint M, Palauqui JC, Martínez-García JF, Wenkel S - Genome-wide binding-site analysis of REVOLUTA reveals a link between leaf patterning and light-mediated growth responses

• DNA-protein Interaction

To test whether AtISWI directly regulates the selected genes, we performed a chromatin immunoprecipitation (ChIP) assay by using the transgenic CHR11pro:FLAG-CHR17/chr11-1 chr17-1 plants (Figure S1). The result showed that FLAG-CHR17 was enriched in the promoter and transcribed regions of the ... FT loci

Li G, Zhang J, Li J, Yang Z, Huang H, Xu L - Imitation Switch chromatin remodeling factors and their interacting RINGLET proteins act together in controlling the plant vegetative phase in Arabidopsis

• DNA-protein Interaction

To test whether AtISWI directly regulates the selected genes, we performed a chromatin immunoprecipitation (ChIP) assay by using the transgenic CHR11pro:FLAG-CHR17/chr11-1 chr17-1 plants (Figure S1). The result showed that FLAG-CHR17 was enriched in the promoter and transcribed regions of the SEP3

Li G, Zhang J, Li J, Yang Z, Huang H, Xu L - Imitation Switch chromatin remodeling factors and their interacting RINGLET proteins act together in controlling the plant vegetative phase in Arabidopsis

• DNA-protein Interaction

Subsequently, we analyzed the binding capacities of the potential TCP20 dimers to the LOX2 promoter in a modified yeast one-hybrid assay, showing that the TCP20-TCP8 ... dimers are able to bind the LOX2 promoter region containing the -2799 bp TGGGCC motif

Danisman S, van der Wal F, Dhondt S, Waites R, de Folter S, Bimbo A, van Dijk AD, Muino JM, Cutri L, Dornelas MC, Angenent GC, Immink RG - Arabidopsis class I and class II TCP transcription factors regulate jasmonic acid metabolism and leaf development antagonistically

• DNA-protein Interaction

ChIP was performed on homozygous gTCP20-GFP plants to provide evidence for direct binding of TCP20 to the TCP9 locus. This analysis revealed that the TCP9 promoter can be bound by the TCP20 protein

Danisman S, van der Wal F, Dhondt S, Waites R, de Folter S, Bimbo A, van Dijk AD, Muino JM, Cutri L, Dornelas MC, Angenent GC, Immink RG - Arabidopsis class I and class II TCP transcription factors regulate jasmonic acid metabolism and leaf development antagonistically

• DNA-protein Interaction

binding of TCP20 to the LOX2 promoter was analyzed using a Chromatin Immunoprecipitation (ChIP) assay followed by real-time PCR ... The qRT-PCR experiment showed significant enrichment for the -2799 bp TGGGCC motif only

Danisman S, van der Wal F, Dhondt S, Waites R, de Folter S, Bimbo A, van Dijk AD, Muino JM, Cutri L, Dornelas MC, Angenent GC, Immink RG - Arabidopsis class I and class II TCP transcription factors regulate jasmonic acid metabolism and leaf development antagonistically

• DNA-protein Interaction

Subsequently, we analyzed the binding capacities of the potential TCP20 dimers to the LOX2 promoter in a modified yeast one-hybrid assay, showing that the ... TCP20-TCP22 dimers are able to bind the LOX2 promoter region containing the -2799 bp TGGGCC motif

Danisman S, van der Wal F, Dhondt S, Waites R, de Folter S, Bimbo A, van Dijk AD, Muino JM, Cutri L, Dornelas MC, Angenent GC, Immink RG - Arabidopsis class I and class II TCP transcription factors regulate jasmonic acid metabolism and leaf development antagonistically

• DNA-protein Interaction

Subsequently, we analyzed the binding capacities of the potential TCP20 dimers to the LOX2 promoter in a modified yeast one-hybrid assay, showing that the ... TCP20-TCP22 dimers are able to bind the LOX2 promoter region containing the -2799 bp TGGGCC motif

Danisman S, van der Wal F, Dhondt S, Waites R, de Folter S, Bimbo A, van Dijk AD, Muino JM, Cutri L, Dornelas MC, Angenent GC, Immink RG - Arabidopsis class I and class II TCP transcription factors regulate jasmonic acid metabolism and leaf development antagonistically

• DNA-protein Interaction

Subsequently, we analyzed the binding capacities of the potential TCP20 dimers to the LOX2 promoter in a modified yeast one-hybrid assay, showing that the TCP20-TCP8 ... dimers are able to bind the LOX2 promoter region containing the -2799 bp TGGGCC motif

Danisman S, van der Wal F, Dhondt S, Waites R, de Folter S, Bimbo A, van Dijk AD, Muino JM, Cutri L, Dornelas MC, Angenent GC, Immink RG - Arabidopsis class I and class II TCP transcription factors regulate jasmonic acid metabolism and leaf development antagonistically

• DNA-protein Interaction

To confirm physical interaction of the candidate transcription factors with the promoter of CESA4, we performed EMSAs using ... WRKY11 (At4g31550) ... fused to GST specifically bound the -666 to -294 bp region of the CESA4 promoter ... Furthermore, a transcriptional activation assay showed that ... the transcription factor ... activated transcription of CESA4

Kim WC, Ko JH, Kim JY, Kim JM, Bae HJ, Han KH - MYB46 directly regulates the gene expression of secondary wall-associated cellulose synthases in Arabidopsis

• DNA-protein Interaction

As secondary wall cellulose biosynthesis is critical in plant growth, we reasoned that there may be additional transcriptional regulators. To test this hypothesis, we performed yeast one-hybrid screening using the promoter sequences of CESA4, CESA7 and CESA8 as baits, and REGIA transcription factors (REgulatory Gene Initiative in Arabidopsis; Paz-Ares and the REGIA Consortium, 2002) that had been fused to the GAL4 activation domain (provided by Y. Kim and M.F. Thomashow, DOE-Plant Research Laboratory, Michigan State University, East Lansing, MI) as prey. Positive candidates were isolated under high-stringency conditions (SD medium lacking His, Ura and Trp and containing 40 mm 3-aminotriazole), and tested for ß-galactosidase expression ... Putative regulators of secondary wall CESA genes identified by yeast one-hybrid screening ... Promoter regions used in this analysis were -668 to -1 bp (CESA4) ... At5g07580 ... AP2/EREBP

Kim WC, Ko JH, Kim JY, Kim JM, Bae HJ, Han KH - MYB46 directly regulates the gene expression of secondary wall-associated cellulose synthases in Arabidopsis

• DNA-protein Interaction

To confirm physical interaction of the candidate transcription factors with the promoter of CESA4, we performed EMSAs using ... ERF6 (At4g17490) ... fused to GST specifically bound the -666 to -294 bp region of the CESA4 promoter ... Furthermore, a transcriptional activation assay showed that ... the transcription factor ... activated transcription of CESA4

Kim WC, Ko JH, Kim JY, Kim JM, Bae HJ, Han KH - MYB46 directly regulates the gene expression of secondary wall-associated cellulose synthases in Arabidopsis

• DNA-protein Interaction

CESA8 ... To further corroborate the interaction of MYB46 protein with the three CESA promoters in vivo, we performed a chromatin immunoprecipitation (ChIP) assay using transgenic Arabidopsis plants that expressed the GFP-tagged MYB46 gene under the control of the DEX-inducible promoter ... Formaldehyde cross-linked chromatin from leaf tissues collected from 3-week-old transgenic plants with or without DEX treatment was isolated and fragmented. Chromatin fragments from plants without DEX treatment were used as a negative control. MYB46-GFP-bound DNA fragments were immunoprecipitated using GFP antibody and used as templates in quantitative real-time PCR analysis of CESA promoter sequences. All three CESA promoters were highly enriched (three to eightfold) compared to control DNA (Figure 4b). In the ChIP analysis, we used the promoter regions of C3H14 and MYB54 as positive and negative controls, respectively, as MYB54 is not directly targeted by MYB46 (Kim et al., 2012

Kim WC, Ko JH, Kim JY, Kim JM, Bae HJ, Han KH - MYB46 directly regulates the gene expression of secondary wall-associated cellulose synthases in Arabidopsis

• DNA-protein Interaction

To confirm physical interaction of MYB46 protein with the promoter ... of CESA4 ... we performed electrophoretic mobility shift assays (EMSAs) using recombinant MYB46 proteins fused to glutathione S-transferase (GST-MYB46) and a CESA promoter fragment containing a M46RE motif ... Specific binding of MYB46 to the 32P-labeled promoter fragments ProCESA4 (-248 to -69 ... was established using non-labeled promoter fragments (e.g. ProCESA4_wt, Figure 3a) as a competitor (Figure 3b). The binding specificity was further confirmed by using non-labeled promoter fragments with single base mutations in the M46RE (e.g. ProCESA4_m1 or m2) as a competitor. As expected, the MYB46 protein bound to the CESA promoter ... but the GST protein alone did not (Figure 3b), demonstrating interaction of MYB46 protein with the promoters of the three CESA genes in vitro

Kim WC, Ko JH, Kim JY, Kim JM, Bae HJ, Han KH - MYB46 directly regulates the gene expression of secondary wall-associated cellulose synthases in Arabidopsis

• DNA-protein Interaction

As secondary wall cellulose biosynthesis is critical in plant growth, we reasoned that there may be additional transcriptional regulators. To test this hypothesis, we performed yeast one-hybrid screening using the promoter sequences of CESA4, CESA7 and CESA8 as baits, and REGIA transcription factors (REgulatory Gene Initiative in Arabidopsis; Paz-Ares and the REGIA Consortium, 2002) that had been fused to the GAL4 activation domain (provided by Y. Kim and M.F. Thomashow, DOE-Plant Research Laboratory, Michigan State University, East Lansing, MI) as prey. Positive candidates were isolated under high-stringency conditions (SD medium lacking His, Ura and Trp and containing 40 mm 3-aminotriazole), and tested for ß-galactosidase expression ... Putative regulators of secondary wall CESA genes identified by yeast one-hybrid screening ... Promoter regions used in this analysis were -668 to -1 bp (CESA4) ... At2g01430 ... ATHB17

Kim WC, Ko JH, Kim JY, Kim JM, Bae HJ, Han KH - MYB46 directly regulates the gene expression of secondary wall-associated cellulose synthases in Arabidopsis

• DNA-protein Interaction

CESA4 ... To further corroborate the interaction of MYB46 protein with the three CESA promoters in vivo, we performed a chromatin immunoprecipitation (ChIP) assay using transgenic Arabidopsis plants that expressed the GFP-tagged MYB46 gene under the control of the DEX-inducible promoter ... Formaldehyde cross-linked chromatin from leaf tissues collected from 3-week-old transgenic plants with or without DEX treatment was isolated and fragmented. Chromatin fragments from plants without DEX treatment were used as a negative control. MYB46-GFP-bound DNA fragments were immunoprecipitated using GFP antibody and used as templates in quantitative real-time PCR analysis of CESA promoter sequences. All three CESA promoters were highly enriched (three to eightfold) compared to control DNA (Figure 4b). In the ChIP analysis, we used the promoter regions of C3H14 and MYB54 as positive and negative controls, respectively, as MYB54 is not directly targeted by MYB46 (Kim et al., 2012

Kim WC, Ko JH, Kim JY, Kim JM, Bae HJ, Han KH - MYB46 directly regulates the gene expression of secondary wall-associated cellulose synthases in Arabidopsis

• DNA-protein Interaction

As secondary wall cellulose biosynthesis is critical in plant growth, we reasoned that there may be additional transcriptional regulators. To test this hypothesis, we performed yeast one-hybrid screening using the promoter sequences of CESA4, CESA7 and CESA8 as baits, and REGIA transcription factors (REgulatory Gene Initiative in Arabidopsis; Paz-Ares and the REGIA Consortium, 2002) that had been fused to the GAL4 activation domain (provided by Y. Kim and M.F. Thomashow, DOE-Plant Research Laboratory, Michigan State University, East Lansing, MI) as prey. Positive candidates were isolated under high-stringency conditions (SD medium lacking His, Ura and Trp and containing 40 mm 3-aminotriazole), and tested for ß-galactosidase expression ... Putative regulators of secondary wall CESA genes identified by yeast one-hybrid screening ... Promoter regions used in this analysis were -668 to -1 bp (CESA4) ... At1g77570 ... HSTF15

Kim WC, Ko JH, Kim JY, Kim JM, Bae HJ, Han KH - MYB46 directly regulates the gene expression of secondary wall-associated cellulose synthases in Arabidopsis

• DNA-protein Interaction

As secondary wall cellulose biosynthesis is critical in plant growth, we reasoned that there may be additional transcriptional regulators. To test this hypothesis, we performed yeast one-hybrid screening using the promoter sequences of CESA4, CESA7 and CESA8 as baits, and REGIA transcription factors (REgulatory Gene Initiative in Arabidopsis; Paz-Ares and the REGIA Consortium, 2002) that had been fused to the GAL4 activation domain (provided by Y. Kim and M.F. Thomashow, DOE-Plant Research Laboratory, Michigan State University, East Lansing, MI) as prey. Positive candidates were isolated under high-stringency conditions (SD medium lacking His, Ura and Trp and containing 40 mm 3-aminotriazole), and tested for ß-galactosidase expression ... Putative regulators of secondary wall CESA genes identified by yeast one-hybrid screening ... Promoter regions used in this analysis were -668 to -1 bp (CESA4) ... At1g51950 ... IAA18

Kim WC, Ko JH, Kim JY, Kim JM, Bae HJ, Han KH - MYB46 directly regulates the gene expression of secondary wall-associated cellulose synthases in Arabidopsis

• DNA-protein Interaction

As secondary wall cellulose biosynthesis is critical in plant growth, we reasoned that there may be additional transcriptional regulators. To test this hypothesis, we performed yeast one-hybrid screening using the promoter sequences of CESA4, CESA7 and CESA8 as baits, and REGIA transcription factors (REgulatory Gene Initiative in Arabidopsis; Paz-Ares and the REGIA Consortium, 2002) that had been fused to the GAL4 activation domain (provided by Y. Kim and M.F. Thomashow, DOE-Plant Research Laboratory, Michigan State University, East Lansing, MI) as prey. Positive candidates were isolated under high-stringency conditions (SD medium lacking His, Ura and Trp and containing 40 mm 3-aminotriazole), and tested for ß-galactosidase expression ... ZAT7 (At3g46090) ... bound to the CESA7 promoter

Kim WC, Ko JH, Kim JY, Kim JM, Bae HJ, Han KH - MYB46 directly regulates the gene expression of secondary wall-associated cellulose synthases in Arabidopsis

• DNA-protein Interaction

To confirm physical interaction of MYB46 protein with the promoter ... of ... CESA7 ... we performed electrophoretic mobility shift assays (EMSAs) using recombinant MYB46 proteins fused to glutathione S-transferase (GST-MYB46) and a CESA promoter fragment containing a M46RE motif ... Specific binding of MYB46 to the 32P-labeled promoter fragments ... ProCESA7 (-662 to -486 ... was established using non-labeled promoter fragments (e.g. ProCESA4_wt, Figure 3a) as a competitor (Figure 3b). The binding specificity was further confirmed by using non-labeled promoter fragments with single base mutations in the M46RE (e.g. ProCESA4_m1 or m2) as a competitor. As expected, the MYB46 protein bound to the CESA promoter ... but the GST protein alone did not (Figure 3b), demonstrating interaction of MYB46 protein with the promoters of the three CESA genes in vitro

Kim WC, Ko JH, Kim JY, Kim JM, Bae HJ, Han KH - MYB46 directly regulates the gene expression of secondary wall-associated cellulose synthases in Arabidopsis

• DNA-protein Interaction

To confirm physical interaction of the candidate transcription factors with the promoter of CESA4, we performed EMSAs using ... MYB112 (At1g48000) ... fused to GST specifically bound the -666 to -294 bp region of the CESA4 promoter ... Furthermore, a transcriptional activation assay showed that ... the transcription factor ... activated transcription of CESA4 ... Interestingly, MYB112 activated all three CESA genes, even though it does not bind to CESA7 and CESA8 promoters, suggesting that this activation may be indirect

Kim WC, Ko JH, Kim JY, Kim JM, Bae HJ, Han KH - MYB46 directly regulates the gene expression of secondary wall-associated cellulose synthases in Arabidopsis

• DNA-protein Interaction

As secondary wall cellulose biosynthesis is critical in plant growth, we reasoned that there may be additional transcriptional regulators. To test this hypothesis, we performed yeast one-hybrid screening using the promoter sequences of CESA4, CESA7 and CESA8 as baits, and REGIA transcription factors (REgulatory Gene Initiative in Arabidopsis; Paz-Ares and the REGIA Consortium, 2002) that had been fused to the GAL4 activation domain (provided by Y. Kim and M.F. Thomashow, DOE-Plant Research Laboratory, Michigan State University, East Lansing, MI) as prey. Positive candidates were isolated under high-stringency conditions (SD medium lacking His, Ura and Trp and containing 40 mm 3-aminotriazole), and tested for ß-galactosidase expression ... Putative regulators of secondary wall CESA genes identified by yeast one-hybrid screening ... Promoter regions used in this analysis were -668 to -1 bp (CESA4) ... At1g60880 ... AGL56

Kim WC, Ko JH, Kim JY, Kim JM, Bae HJ, Han KH - MYB46 directly regulates the gene expression of secondary wall-associated cellulose synthases in Arabidopsis

• DNA-protein Interaction

As secondary wall cellulose biosynthesis is critical in plant growth, we reasoned that there may be additional transcriptional regulators. To test this hypothesis, we performed yeast one-hybrid screening using the promoter sequences of CESA4, CESA7 and CESA8 as baits, and REGIA transcription factors (REgulatory Gene Initiative in Arabidopsis; Paz-Ares and the REGIA Consortium, 2002) that had been fused to the GAL4 activation domain (provided by Y. Kim and M.F. Thomashow, DOE-Plant Research Laboratory, Michigan State University, East Lansing, MI) as prey. Positive candidates were isolated under high-stringency conditions (SD medium lacking His, Ura and Trp and containing 40 mm 3-aminotriazole), and tested for ß-galactosidase expression ... Putative regulators of secondary wall CESA genes identified by yeast one-hybrid screeningAGI ... Promoter regions used in this analysis were -668 to -1 bp (CESA4 ... At1g54760 ... AGL85

Kim WC, Ko JH, Kim JY, Kim JM, Bae HJ, Han KH - MYB46 directly regulates the gene expression of secondary wall-associated cellulose synthases in Arabidopsis

• DNA-protein Interaction

As secondary wall cellulose biosynthesis is critical in plant growth, we reasoned that there may be additional transcriptional regulators. To test this hypothesis, we performed yeast one-hybrid screening using the promoter sequences of CESA4, CESA7 and CESA8 as baits, and REGIA transcription factors (REgulatory Gene Initiative in Arabidopsis; Paz-Ares and the REGIA Consortium, 2002) that had been fused to the GAL4 activation domain (provided by Y. Kim and M.F. Thomashow, DOE-Plant Research Laboratory, Michigan State University, East Lansing, MI) as prey. Positive candidates were isolated under high-stringency conditions (SD medium lacking His, Ura and Trp and containing 40 mm 3-aminotriazole), and tested for ß-galactosidase expression ... Putative regulators of secondary wall CESA genes identified by yeast one-hybrid screening ... Promoter regions used in this analysis were -668 to -1 bp (CESA4) ... At5g26630 ... AGL35

Kim WC, Ko JH, Kim JY, Kim JM, Bae HJ, Han KH - MYB46 directly regulates the gene expression of secondary wall-associated cellulose synthases in Arabidopsis

• DNA-protein Interaction

As secondary wall cellulose biosynthesis is critical in plant growth, we reasoned that there may be additional transcriptional regulators. To test this hypothesis, we performed yeast one-hybrid screening using the promoter sequences of CESA4, CESA7 and CESA8 as baits, and REGIA transcription factors (REgulatory Gene Initiative in Arabidopsis; Paz-Ares and the REGIA Consortium, 2002) that had been fused to the GAL4 activation domain (provided by Y. Kim and M.F. Thomashow, DOE-Plant Research Laboratory, Michigan State University, East Lansing, MI) as prey. Positive candidates were isolated under high-stringency conditions (SD medium lacking His, Ura and Trp and containing 40 mm 3-aminotriazole), and tested for ß-galactosidase expression ... Putative regulators of secondary wall CESA genes identified by yeast one-hybrid screening ... Promoter regions used in this analysis were -668 to -1 bp (CESA4) ... At4g26150 ... GATA22/CGA1

Kim WC, Ko JH, Kim JY, Kim JM, Bae HJ, Han KH - MYB46 directly regulates the gene expression of secondary wall-associated cellulose synthases in Arabidopsis

• DNA-protein Interaction

To confirm physical interaction of MYB46 protein with the promoter ... of ... CESA8 ... we performed electrophoretic mobility shift assays (EMSAs) using recombinant MYB46 proteins fused to glutathione S-transferase (GST-MYB46) and a CESA promoter fragment containing a M46RE motif ... Specific binding of MYB46 to the 32P-labeled promoter ... ProCESA8 (-525 to -358) was established using non-labeled promoter fragments (e.g. ProCESA4_wt, Figure 3a) as a competitor (Figure 3b). The binding specificity was further confirmed by using non-labeled promoter fragments with single base mutations in the M46RE (e.g. ProCESA4_m1 or m2) as a competitor. As expected, the MYB46 protein bound to the CESA promoter ... but the GST protein alone did not (Figure 3b), demonstrating interaction of MYB46 protein with the promoters of the three CESA genes in vitro

Kim WC, Ko JH, Kim JY, Kim JM, Bae HJ, Han KH - MYB46 directly regulates the gene expression of secondary wall-associated cellulose synthases in Arabidopsis

• DNA-protein Interaction

CESA7 ... To further corroborate the interaction of MYB46 protein with the three CESA promoters in vivo, we performed a chromatin immunoprecipitation (ChIP) assay using transgenic Arabidopsis plants that expressed the GFP-tagged MYB46 gene under the control of the DEX-inducible promoter ... Formaldehyde cross-linked chromatin from leaf tissues collected from 3-week-old transgenic plants with or without DEX treatment was isolated and fragmented. Chromatin fragments from plants without DEX treatment were used as a negative control. MYB46-GFP-bound DNA fragments were immunoprecipitated using GFP antibody and used as templates in quantitative real-time PCR analysis of CESA promoter sequences. All three CESA promoters were highly enriched (three to eightfold) compared to control DNA (Figure 4b). In the ChIP analysis, we used the promoter regions of C3H14 and MYB54 as positive and negative controls, respectively, as MYB54 is not directly targeted by MYB46 (Kim et al., 2012

Kim WC, Ko JH, Kim JY, Kim JM, Bae HJ, Han KH - MYB46 directly regulates the gene expression of secondary wall-associated cellulose synthases in Arabidopsis

• DNA-protein Interaction

As secondary wall cellulose biosynthesis is critical in plant growth, we reasoned that there may be additional transcriptional regulators. To test this hypothesis, we performed yeast one-hybrid screening using the promoter sequences of CESA4, CESA7 and CESA8 as baits, and REGIA transcription factors (REgulatory Gene Initiative in Arabidopsis; Paz-Ares and the REGIA Consortium, 2002) that had been fused to the GAL4 activation domain (provided by Y. Kim and M.F. Thomashow, DOE-Plant Research Laboratory, Michigan State University, East Lansing, MI) as prey. Positive candidates were isolated under high-stringency conditions (SD medium lacking His, Ura and Trp and containing 40 mm 3-aminotriazole), and tested for ß-galactosidase expression ... Putative regulators of secondary wall CESA genes identified by yeast one-hybrid screening ... Promoter regions used in this analysis were -668 to -1 bp (CESA4) ... At5g61590 ... ERF5

Kim WC, Ko JH, Kim JY, Kim JM, Bae HJ, Han KH - MYB46 directly regulates the gene expression of secondary wall-associated cellulose synthases in Arabidopsis

• DNA-protein Interaction

Arabidopsis protoplasts were transformed with HA-tagged ARF7, 8 or 19, and chromatin associated with ARF proteins was isolated using monoclonal anti-HA antibodies. This experiment showed that the BAT1 promoter directly bound to ARF19, but not to ARF7 or 8 (Figure 6b), indicating a key role for ARF19 in BAT1 regulation

Choi S, Cho YH, Kim K, Matsui M, Son SH, Kim SK, Fujioka S, Hwang I - BAT1, a putative acyltransferase, modulates brassinosteroid levels in Arabidopsis

• DNA-protein Interaction

We used 6-day-old wild-type (not carrying a transgene) and minu1minu2 seedlings rescued by the pMINU2:MINU2-GFP transgene for chromatin immunoprecipitation to assess MINU2 binding to the WUS and WOX5 regulatory regions. We were unable to see MINU2 association with any of the WUS regulatory regions tested, but did see MINU2 association with the WOX5 promoter region (Figure S8), suggesting that MINU2 can indeed associate with chromatin

Sang Y, Silva-Ortega CO, Wu S, Yamaguchi N, Wu MF, Pfluger J, Gillmor CS, Gallagher KL, Wagner D - Mutations in two non-canonical Arabidopsis SWI2/SNF2 chromatin remodeling ATPases cause embryogenesis and stem cell maintenance defects

• DNA-protein Interaction

To determine whether RPX binds the PRCE element, we devised an in vitro assay named infrared-mediated mapping (IMAP). In short, glutathione-S–transferase (GST)-fused RPX was immobilized on glutathione disulfide beads and incubated with infrared-labeled DNA probes based on the PRCE-containing sequence of the RPN10 promoter (RPN10 is a proteasome subunit). RPX bound to probe 1 (P1) encompassing the conserved PRCE element, but not to two control probes (P2 and P3) derived from other parts of the RPN10 promoter that lack a PRCE motif

Nguyen HM, Schippers JH, Gõni-Ramos O, Christoph MP, Dortay H, van der Hoorn RA, Mueller-Roeber B - An upstream regulator of the 26S proteasome modulates organ size in Arabidopsis thaliana

• DNA-protein Interaction

Direct binding of RPX to the promoters of the 26S proteasome genes in vivo was further assessed by chromatin immunoprecipitation (ChIP)/quantitative PCR assay using a functional RPX–GFP fusion protein expressed in transgenic Arabidopsis ... We also found that RPX binds to the 3' UTR of RPN8a, which contains an imperfect PRCE

Nguyen HM, Schippers JH, Gõni-Ramos O, Christoph MP, Dortay H, van der Hoorn RA, Mueller-Roeber B - An upstream regulator of the 26S proteasome modulates organ size in Arabidopsis thaliana

• DNA-protein Interaction

RPN10 ... Direct binding of RPX to the promoters of the 26S proteasome genes in vivo was further assessed by chromatin immunoprecipitation (ChIP)/quantitative PCR assay using a functional RPX–GFP fusion protein expressed in transgenic Arabidopsis ... we obtained an enrichment with primers spanning the PRCE motif that was not seen for the downstream sequences

Nguyen HM, Schippers JH, Gõni-Ramos O, Christoph MP, Dortay H, van der Hoorn RA, Mueller-Roeber B - An upstream regulator of the 26S proteasome modulates organ size in Arabidopsis thaliana

• DNA-protein Interaction

To verify whether RPX regulates the expression of 26S proteasome-encoding genes in vivo, we assayed its transactivation capacity towards ... RPT6a, encoding a regulatory particle triple AATPase ... Mesophyll cell protoplasts were co-transformed with a vector containing the target promoter upstream of the firefly luciferase (fLUC) coding sequence (reporter), a control vector expressing Renilla luciferase (Licausi et al., 2011), and an effector plasmid expressing RPX from the CaMV 35S promoter. A significant increase in relative fLUC activity was observed

Nguyen HM, Schippers JH, Gõni-Ramos O, Christoph MP, Dortay H, van der Hoorn RA, Mueller-Roeber B - An upstream regulator of the 26S proteasome modulates organ size in Arabidopsis thaliana

• DNA-protein Interaction

Direct binding of RPX to the promoters of the 26S proteasome genes in vivo was further assessed by chromatin immunoprecipitation (ChIP)/quantitative PCR assay using a functional RPX–GFP fusion protein expressed in transgenic Arabidopsis ... PA200 protein ... we obtained an enrichment with primers spanning the PRCE motif that was not seen for the downstream sequences

Nguyen HM, Schippers JH, Gõni-Ramos O, Christoph MP, Dortay H, van der Hoorn RA, Mueller-Roeber B - An upstream regulator of the 26S proteasome modulates organ size in Arabidopsis thaliana

• DNA-protein Interaction

In addition, RPX fusion proteins generated in vivo and in vitro were used in an electrophoretic mobility shift assay (EMSA) and shown to bind the PRCE element derived from the RPN8a

Nguyen HM, Schippers JH, Gõni-Ramos O, Christoph MP, Dortay H, van der Hoorn RA, Mueller-Roeber B - An upstream regulator of the 26S proteasome modulates organ size in Arabidopsis thaliana

• DNA-protein Interaction

Direct binding of RPX to the promoters of the 26S proteasome genes in vivo was further assessed by chromatin immunoprecipitation (ChIP)/quantitative PCR assay using a functional RPX–GFP fusion protein expressed in transgenic Arabidopsis ... UMP1-like chaperone ... we obtained an enrichment with primers spanning the PRCE motif that was not seen for the downstream sequences

Nguyen HM, Schippers JH, Gõni-Ramos O, Christoph MP, Dortay H, van der Hoorn RA, Mueller-Roeber B - An upstream regulator of the 26S proteasome modulates organ size in Arabidopsis thaliana

• DNA-protein Interaction

To verify whether RPX regulates the expression of 26S proteasome-encoding genes in vivo, we assayed its transactivation capacity towards ... RPN12a ... Mesophyll cell protoplasts were co-transformed with a vector containing the target promoter upstream of the firefly luciferase (fLUC) coding sequence (reporter), a control vector expressing Renilla luciferase (Licausi et al., 2011), and an effector plasmid expressing RPX from the CaMV 35S promoter. A significant increase in relative fLUC activity was observed

Nguyen HM, Schippers JH, Gõni-Ramos O, Christoph MP, Dortay H, van der Hoorn RA, Mueller-Roeber B - An upstream regulator of the 26S proteasome modulates organ size in Arabidopsis thaliana

• DNA-protein Interaction

To verify whether RPX regulates the expression of 26S proteasome-encoding genes in vivo, we assayed its transactivation capacity towards ... PBE1, encoding a catalytic subunit of the 20S core ... Mesophyll cell protoplasts were co-transformed with a vector containing the target promoter upstream of the firefly luciferase (fLUC) coding sequence (reporter), a control vector expressing Renilla luciferase (Licausi et al., 2011), and an effector plasmid expressing RPX from the CaMV 35S promoter. A significant increase in relative fLUC activity was observed

Nguyen HM, Schippers JH, Gõni-Ramos O, Christoph MP, Dortay H, van der Hoorn RA, Mueller-Roeber B - An upstream regulator of the 26S proteasome modulates organ size in Arabidopsis thaliana

• DNA-protein Interaction

RPX fusion proteins generated in vivo and in vitro were used in an electrophoretic mobility shift assay (EMSA) and shown to bind the PRCE element derived from the ... RPN10

Nguyen HM, Schippers JH, Gõni-Ramos O, Christoph MP, Dortay H, van der Hoorn RA, Mueller-Roeber B - An upstream regulator of the 26S proteasome modulates organ size in Arabidopsis thaliana

• DNA-protein Interaction

To verify whether RPX regulates the expression of 26S proteasome-encoding genes in vivo, we assayed its transactivation capacity towards ... RPN10 ... Mesophyll cell protoplasts were co-transformed with a vector containing the target promoter upstream of the firefly luciferase (fLUC) coding sequence (reporter), a control vector expressing Renilla luciferase (Licausi et al., 2011), and an effector plasmid expressing RPX from the CaMV 35S promoter. A significant increase in relative fLUC activity was observed

Nguyen HM, Schippers JH, Gõni-Ramos O, Christoph MP, Dortay H, van der Hoorn RA, Mueller-Roeber B - An upstream regulator of the 26S proteasome modulates organ size in Arabidopsis thaliana

• DNA-protein Interaction

To test whether SPL7 binds to the MIR408 promoter via the GTAC motifs, we fused its N–terminus portion (amino acids 1–297) containing the conserved DNA binding domain (SBP) with a His tag. The purified recombinant SPL7-SBP protein from Escherichia coli was then used in a series of electrophoretic mobility shift assays (Figure 6a). We found that digoxigenin-labeled probes I (from -351 to -312 upstream the TSS, including three GTAC motifs), II (from -293 to -266, including two GTAC motifs) and III (from -130 to -91, including two GTAC motifs), but not probe IV (from -77 to -45, including two GTAC motifs), were retarded by the addition of the SPL7-SBP recombinant protein (Figure 6b). In the presence of excessive unlabeled probes, binding between SPL7-SBP and probes II and III was effectively impaired (Figure 6b). By contrast, the competitor probe did not significantly change the shift pattern of probe I (Figure 6b). These results suggest that SPL7 binds to the MIR408 promoter mainly through the GTAC motifs located in the middle of the proximal promoter region

Zhang H, Li L - SQUAMOSA promoter binding protein-like7 regulated microRNA408 is required for vegetative development in Arabidopsis

• DNA-protein Interaction

the ChIP-quantitative PCR (ChIP-qPCR) analyses showed that WRKY8 interacted with one W-box element in the promoter of RD29A after NaCl treatment. These results suggested that WRKY8 directly regulates RD29A transcription under salt stress

Hu Y, Chen L, Wang H, Zhang L, Wang F, Yu D - Arabidopsis transcription factor WRKY8 functions antagonistically with its interacting partner VQ9 to modulate salinity stress tolerance

• DNA-protein Interaction

we performed ChIP using rev-5 seedlings expressing REV:GFP driven by the REV promoter, which complements the mutant phenotype (Lee et al., 2006) (G.M., unpublished). Fragment C of the ATHB2 promoter was over-represented in the immunoprecipitated chromatin, demonstrating direct binding to REV:GFP

Turchi L, Carabelli M, Ruzza V, Possenti M, Sassi M, Peñalosa A, Sessa G, Salvi S, Forte V, Morelli G, Ruberti I - Arabidopsis HD-Zip II transcription factors control apical embryo development and meristem function

• DNA-protein Interaction

To investigate whether HAT3 regulates ATHB2 expression by physically interacting with its promoter, we performed ChIP using seedlings expressing HAT3:GFP driven by the HAT3 promoter. Two fragments of the ATHB2 promoter were over-represented in the immunoprecipitated chromatin, indicating direct binding to HAT3:GFP (Fig. 4C). This, together with the rapid repression of ATHB2 expression upon HAT3 induction indicates that ATHB2 is a direct target of HAT3

Turchi L, Carabelli M, Ruzza V, Possenti M, Sassi M, Peñalosa A, Sessa G, Salvi S, Forte V, Morelli G, Ruberti I - Arabidopsis HD-Zip II transcription factors control apical embryo development and meristem function

• DNA-protein Interaction

To understand the mechanism by which ARC5 is regulated, we first conducted an electrophoretic mobility shift assay (EMSA) to establish whether FHY3/CPD45 could bind directly to the promoter region of ARC5. Since full-length FHY3/CPD45 expressed in Escherichia coli localized to inclusion bodies, we expressed only the first 200 amino acid residues fused to an N-terminal yellow fluorescent protein (YFP) tag (YFP-CPD45N1 ... YFP-CPD45N1 caused a strong up-shift of the biotin-labeled wild-type ARC5 promoter (lane 2). When a 50-fold excess of unlabeled competitor DNA was added to the reaction, only a fraction of the labeled ARC5 promoter DNA was up-shifted as before (lane 3), indicating strong competition for binding to CPD45N1

Gao Y, Liu H, An C, Shi Y, Liu X, Yuan W, Zhang B, Yang J, Yu C, Gao H - Arabidopsis FRS4/CPD25 and FHY3/CPD45 work cooperatively to promote the expression of the chloroplast division gene ARC5 and chloroplast division

• DNA-protein Interaction

To analyze whether FHY3/CPD45 could activate the expression of ARC5 in vivo, a construct containing an ARC5 promoter (which is 657 bp long and includes part of the upstream gene) fused to a GUS reporter gene (uidA) was made and bombarded into the leaves of fhy3/cpd45 plants. GUS was hardly expressed (Figure 6c). However, when this construct was co-transformed with a construct containing FHY3/CPD45 driven by a 35S promoter, GUS was strongly expressed (Figure 6c). GUS was not expressed when all FBS and FBL motifs in the ARC5 promoter were mutated, even when the promoter constructs were co-transformed with 35Spro-CPD45 (Figure 6c). These data further suggest that FHY3/CPD45 can activate the expression of ARC5 in vivo and that the FBS and FBL motifs in the promoter region are essential for the binding and gene activation

Gao Y, Liu H, An C, Shi Y, Liu X, Yuan W, Zhang B, Yang J, Yu C, Gao H - Arabidopsis FRS4/CPD25 and FHY3/CPD45 work cooperatively to promote the expression of the chloroplast division gene ARC5 and chloroplast division

• DNA-protein Interaction

To understand the role of FRS4/CPD25 in the activation of ARC5, the N-terminal DNA-binding domain of FRS4/CPD25 (the first 126 amino acid residues, corresponding to the DNA-binding domain of FHY3/CPD45) fused to an N-terminal YFP tag (YFP-CPD25N1) was expressed in E. coli and purified for EMSA (Figure 8). The DNA probes used were the same as those used for FHY3/CPD45. We found that CPD25N1 could bind to the wild-type ARC5 promoter. The m1, m2, or m1m2 mutation reduced the DNA-binding activity of CPD25N1. In contrast to CPD45N1, CPD25N1 did not bind to the probes with m3, m1m3, and m2m3 mutations, suggesting that the third motif is essential for the DNA-binding activity of CPD25N1 ... A GUS reporter assay similar to the one presented in Figure 8(b) was carried out. 35S promoter-driven FRS4/CPD25 and GUS genes driven by various versions of the ARC5 promoter were co-transformed into the leaves of the fhy3/cpd45 mutant. Although FRS4/CPD25 could strongly bind to the wild-type ARC5 promoter, as shown above, almost no GUS expression was observed in the leaves co-transformed with 35Spro-CPD25 and ARC5pro.WT-GUS. Therefore, FRS4/CPD25 does not have the gene activation activity exhibited by FHY3/CPD45

Gao Y, Liu H, An C, Shi Y, Liu X, Yuan W, Zhang B, Yang J, Yu C, Gao H - Arabidopsis FRS4/CPD25 and FHY3/CPD45 work cooperatively to promote the expression of the chloroplast division gene ARC5 and chloroplast division

• DNA-protein Interaction

Chromatin immunoprecipitation (ChIP) was performed in the pdf2-2 atml1-3 background complemented with pPDF1:FLAG-PDF2 ... enrichment of the L1 box-containing extreme proximal regions of the ACR4 ... was observed compared to a control promoter, only when immunoprecipitation was performed with the antibody corresponding to the expressed tagged protein, consistent with direct binding of PDF2

San-Bento R, Farcot E, Galletti R, Creff A, Ingram G - Epidermal identity is maintained by cell-cell communication via a universally active feedback loop in Arabidopsis thaliana

• DNA-protein Interaction

Chromatin immunoprecipitation (ChIP) was performed in the pdf2-2 atml1-3 background complemented with pPDF1:FLAG-PDF2 ... enrichment of the L1 box-containing extreme proximal regions of the ... ATML1 ... was observed compared to a control promoter, only when immunoprecipitation was performed with the antibody corresponding to the expressed tagged protein, consistent with direct binding of PDF2

San-Bento R, Farcot E, Galletti R, Creff A, Ingram G - Epidermal identity is maintained by cell-cell communication via a universally active feedback loop in Arabidopsis thaliana

• DNA-protein Interaction

Chromatin immunoprecipitation (ChIP) was performed in the pdf2-2 atml1-3 background complemented with ... pPDF1:GFP-ATML1 ... enrichment of the L1 box-containing extreme proximal regions of the ... ATML1 ... was observed compared to a control promoter, only when immunoprecipitation was performed with the antibody corresponding to the expressed tagged protein, consistent with direct binding of ... ATML1

San-Bento R, Farcot E, Galletti R, Creff A, Ingram G - Epidermal identity is maintained by cell-cell communication via a universally active feedback loop in Arabidopsis thaliana

• DNA-protein Interaction

Chromatin immunoprecipitation (ChIP) was performed in the pdf2-2 atml1-3 background complemented with ... pPDF1:GFP-ATML1 ... enrichment of the L1 box-containing extreme proximal regions of the ... PDF2 ... was observed compared to a control promoter, only when immunoprecipitation was performed with the antibody corresponding to the expressed tagged protein, consistent with direct binding of ... ATML1

San-Bento R, Farcot E, Galletti R, Creff A, Ingram G - Epidermal identity is maintained by cell-cell communication via a universally active feedback loop in Arabidopsis thaliana

• DNA-protein Interaction

Chromatin immunoprecipitation (ChIP) was performed in the pdf2-2 atml1-3 background complemented with ... pPDF1:GFP-ATML1 ... enrichment of the L1 box-containing extreme proximal regions of the ACR4 ... was observed compared to a control promoter, only when immunoprecipitation was performed with the antibody corresponding to the expressed tagged protein, consistent with direct binding of ... ATML1

San-Bento R, Farcot E, Galletti R, Creff A, Ingram G - Epidermal identity is maintained by cell-cell communication via a universally active feedback loop in Arabidopsis thaliana

• DNA-protein Interaction

Chromatin immunoprecipitation (ChIP) was performed in the pdf2-2 atml1-3 background complemented with pPDF1:FLAG-PDF2 ... enrichment of the L1 box-containing extreme proximal regions of the ... PDF2 ... was observed compared to a control promoter, only when immunoprecipitation was performed with the antibody corresponding to the expressed tagged protein, consistent with direct binding of PDF2

San-Bento R, Farcot E, Galletti R, Creff A, Ingram G - Epidermal identity is maintained by cell-cell communication via a universally active feedback loop in Arabidopsis thaliana

• DNA-protein Interaction

Out of 211 genes identified as putative KAN1 targets by both the ChIP-seq and the tiling array approaches, 21 are involved in auxin response ... DFL1 ... encoding acyl adenylate–forming isozymes that covalently modify indole-3-acetic acid

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

Out of 211 genes identified as putative KAN1 targets by both the ChIP-seq and the tiling array approaches, 21 are involved in auxin response ... auxin influx transporter AUX1

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

Out of 211 genes identified as putative KAN1 targets by both the ChIP-seq and the tiling array approaches, 21 are involved in auxin response ... SAUR-like ... AT1G75590 ... which encode short-lived nuclear proteins involved in auxin signaling by interacting with calmodulin

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

Among the 3151 putative KAN1 target genes selected from the ChIP-seq data analysis, a set of 211 genes was also regulated by KAN1 at 80 and/or 160 minutes post-induction ... LONGIFOLIA 1 (LNG1)

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

MIR166A ... identified as KAN1 targets exclusively through the ChIP-seq approach

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

five genes are bound by REV and KAN1 in a region less than 100bp apart, suggesting that, besides dual regulation, REV and KAN1 might also compete for chromatin accessibility ... NPH3-like ... AT3G15570

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

Out of 211 genes identified as putative KAN1 targets by both the ChIP-seq and the tiling array approaches, 21 are involved in auxin response ... DFL2 ... encoding acyl adenylate–forming isozymes that covalently modify indole-3-acetic acid

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

Out of 211 genes identified as putative KAN1 targets by both the ChIP-seq and the tiling array approaches, 21 are involved in auxin response ... PIN3

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

five genes are bound by REV and KAN1 in a region less than 100bp apart, suggesting that, besides dual regulation, REV and KAN1 might also compete for chromatin accessibility ... TEM

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

Among the 3151 putative KAN1 target genes selected from the ChIP-seq data analysis, a set of 211 genes was also regulated by KAN1 at 80 and/or 160 minutes post-induction ... the receptor-like kinase PXY/TDR (PHLOEM INTERCALATED WITH XYLEM/TDIF RECEPTOR), involved in the proliferation of procambial cells as well as in the maintenance of polarity during vascular tissue development

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

five genes are bound by REV and KAN1 in a region less than 100bp apart, suggesting that, besides dual regulation, REV and KAN1 might also compete for chromatin accessibility ... ZFP4

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

Among the 3151 putative KAN1 target genes selected from the ChIP-seq data analysis, a set of 211 genes was also regulated by KAN1 at 80 and/or 160 minutes post-induction ... BEL1-like homeodomain protein SAW2 ... associated with leaf shape establishment

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

Out of 211 genes identified as putative KAN1 targets by both the ChIP-seq and the tiling array approaches, 21 are involved in auxin response ... early auxin-regulated genes with a role in auxin signaling pathways such as ... IAA2

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

Out of 211 genes identified as putative KAN1 targets by both the ChIP-seq and the tiling array approaches, 21 are involved in auxin response ... early auxin-regulated genes with a role in auxin signaling pathways such as ... IAA13

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

Among the 3151 putative KAN1 target genes selected from the ChIP-seq data analysis, a set of 211 genes was also regulated by KAN1 at 80 and/or 160 minutes post-induction ... LNG2

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

Among the 3151 putative KAN1 target genes selected from the ChIP-seq data analysis, a set of 211 genes was also regulated by KAN1 at 80 and/or 160 minutes post-induction ... NPY3

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

Out of 211 genes identified as putative KAN1 targets by both the ChIP-seq and the tiling array approaches, 21 are involved in auxin response ... a phospholipase required for PIN protein trafficking to the plasma membrane in the root (phospholipase A2; PLA2A)

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

two ChIP-Seq libraries for 35S:FLAG-GR-KAN1 were sequenced ... The recently identified as2-5d mutation carries a G to A change in the promoter of AS2, causing ectopic AS2 expression due to uncoupling from KAN1 regulation [31]. Our analysis revealed enrichment at three positions in the AS2 promoter region previously identified to be recognized by KAN1. The sequence underlying the peak in the 5’ UTR of AS2 contains the VGAATAW motif, with the G being exchanged for A in as2-5d (Figure 2A). This finding supports the idea that the 1802 binding regions containing the VGAATAW motif are recognized by KAN1 and represent genuine binding regions. Regions for which we can detect enrichment in our ChIP-Seq dataset which do not contain the VGAATAW motif might represent regions where KAN1 is associated to, maybe in complex with other DNA-binding proteins

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

Among the 3151 putative KAN1 target genes selected from the ChIP-seq data analysis, a set of 211 genes was also regulated by KAN1 at 80 and/or 160 minutes post-induction ... controlling organ patterning: PHABULOSA (PHB)

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

Out of 211 genes identified as putative KAN1 targets by both the ChIP-seq and the tiling array approaches, 21 are involved in auxin response ... WES1 ... encoding acyl adenylate–forming isozymes that covalently modify indole-3-acetic acid

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

five genes are bound by REV and KAN1 in a region less than 100bp apart, suggesting that, besides dual regulation, REV and KAN1 might also compete for chromatin accessibility ... SUC1

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

five genes are bound by REV and KAN1 in a region less than 100bp apart, suggesting that, besides dual regulation, REV and KAN1 might also compete for chromatin accessibility ... receptor protein kinase ... AT3G56050

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

Among the 3151 putative KAN1 target genes selected from the ChIP-seq data analysis, a set of 211 genes was also regulated by KAN1 at 80 and/or 160 minutes post-induction ... controlling organ patterning ... ATHB8

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

Out of 211 genes identified as putative KAN1 targets by both the ChIP-seq and the tiling array approaches, 21 are involved in auxin response ... SAUR-like ... AT2G21210 ... which encode short-lived nuclear proteins involved in auxin signaling by interacting with calmodulin

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

Out of 211 genes identified as putative KAN1 targets by both the ChIP-seq and the tiling array approaches, 21 are involved in auxin response ... AUXIN RESPONSE FACTOR gene, ARF4

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

five genes are bound by REV and KAN1 in a region less than 100bp apart, suggesting that, besides dual regulation, REV and KAN1 might also compete for chromatin accessibility ... receptor protein kinase ... AT3G56050

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

five genes are bound by REV and KAN1 in a region less than 100bp apart, suggesting that, besides dual regulation, REV and KAN1 might also compete for chromatin accessibility ... TEM

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

35S:KAN1-GR ... ARF3/ETT was identified only in our ChIP-seq data

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

five genes are bound by REV and KAN1 in a region less than 100bp apart, suggesting that, besides dual regulation, REV and KAN1 might also compete for chromatin accessibility ... NPH3-like protein ... AT3G15570

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

Among the 3151 putative KAN1 target genes selected from the ChIP-seq data analysis, a set of 211 genes was also regulated by KAN1 at 80 and/or 160 minutes post-induction ... controlling organ patterning ... MIR166F, which targets several HD-ZIPIII family members

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

Among the 3151 putative KAN1 target genes selected from the ChIP-seq data analysis, a set of 211 genes was also regulated by KAN1 at 80 and/or 160 minutes post-induction ... the PINOID homolog WAG2, related to auxin-mediated organogenesis

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

Out of 211 genes identified as putative KAN1 targets by both the ChIP-seq and the tiling array approaches, 21 are involved in auxin response ... we also found the class II HD-ZIP gene HAT2, which is an early auxin-inducible gene with opposite functions in regulating auxin-mediated morphogenesis in the shoot and root tissues

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

Out of 211 genes identified as putative KAN1 targets by both the ChIP-seq and the tiling array approaches, 21 are involved in auxin response ... PIN4

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

KAN2 ... isolated as putative targets suggesting that KAN1 may control ... expression of other KAN gene family members

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

five genes are bound by REV and KAN1 in a region less than 100bp apart, suggesting that, besides dual regulation, REV and KAN1 might also compete for chromatin accessibility ... ZFP4

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

Out of 211 genes identified as putative KAN1 targets by both the ChIP-seq and the tiling array approaches, 21 are involved in auxin response ... SAUR-like ... AT1G19840 ... which encode short-lived nuclear proteins involved in auxin signaling by interacting with calmodulin

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

AS2 ... identified as KAN1 targets exclusively through the ChIP-seq approach

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

Out of 211 genes identified as putative KAN1 targets by both the ChIP-seq and the tiling array approaches, 21 are involved in auxin response ... ATP-binding cassette transporter AtMDR1

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

Among the 3151 putative KAN1 target genes selected from the ChIP-seq data analysis, a set of 211 genes was also regulated by KAN1 at 80 and/or 160 minutes post-induction ... NPY5

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

KAN1 ... isolated as putative targets suggesting that KAN1 may control its own expression

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

Out of 211 genes identified as putative KAN1 targets by both the ChIP-seq and the tiling array approaches, 21 are involved in auxin response ... the PINOID protein kinase (PID), which controls PIN polarity and mediates changes in auxin flow to create local gradients for patterning processes

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

Among the 3151 putative KAN1 target genes selected from the ChIP-seq data analysis, a set of 211 genes was also regulated by KAN1 at 80 and/or 160 minutes post-induction ... PIN-FORMED 1 (PIN1), an auxin efflux carrier required for organ formation and positioning

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

five genes are bound by REV and KAN1 in a region less than 100bp apart, suggesting that, besides dual regulation, REV and KAN1 might also compete for chromatin accessibility ... SUC1

Merelo P, Xie Y, Brand L, Ott F, Weigel D, Bowman JL, Heisler MG, Wenkel S - Genome-wide identification of KANADI1 target genes

• DNA-protein Interaction

we examined the promoter of DWF4 ... HAT1 was also able to bind to the WT probe and the binding was also competed off by unlabeled WT probe, but not by the mutant 2 probe in which the putative HB site was mutated ... Moreover, BES1 and HAT1 were able to bind the WT probe together and the binding was competed off by unlabeled WT probe but not by the mutant 3 probe in which both BRRE and HB sites were mutated (Figures 6b lanes 12–16 and S11). The results demonstrated that HAT1 binds to a conserved HB site in the target gene promoters, together with BES1 binding to BRRE, to control gene expression

Zhang D, Ye H, Guo H, Johnson A, Zhang M, Lin H, Yin Y - Transcription factor HAT1 is phosphorylated by BIN2 kinase and mediates brassinosteroid repressed gene expression in Arabidopsis

• DNA-protein Interaction

We also performed ChIP experiments to confirm that HAT1 is a direct target of BES1. The ChIP assay was done using anti-BES1 antibody and a control antibody. TA3, a retrotransposable element, was used as the internal control (Li et al., 2009). In the promoter of HAT1, there are two putative BES1 binding sites. One is BRRE at -941 bp site and the other is the E-box at -1441 bp. ChIP-qPCR was performed (Figure S1c) and the results indicated that BES1 was enriched significantly at BRRE site rather than at E-box or 3' untranslated region. The results confirm that BES1 binds to the HAT1 promoter at the BRRE site to represses HAT1 expression

Zhang D, Ye H, Guo H, Johnson A, Zhang M, Lin H, Yin Y - Transcription factor HAT1 is phosphorylated by BIN2 kinase and mediates brassinosteroid repressed gene expression in Arabidopsis

• DNA-protein Interaction

we examined the promoter of DWF4 ... Electrophoretic mobility shift assays (EMSAs) were carried out to test if HAT1 directly binds to BR target gene promoters with BES1. We designed several DNA probes that contained both BRRE and HB sites or a mutated BRRE with five of the six nucleotides changed or a mutated HB site with eight of the nine nucleotides changed (Figure 6a). The probes were used with the recombinant MBP-BES1 and MBP–HAT1 proteins in the binding assay. BES1 was able to bind to the WT probe, and the binding was competed off by unlabeled WT probe, but not by the mutant 1 probe in which BRRE was mutated ... Moreover, BES1 and HAT1 were able to bind the WT probe together and the binding was competed off by unlabeled WT probe but not by the mutant 3 probe in which both BRRE and HB sites were mutated (Figures 6b lanes 12–16 and S11). The results demonstrated that HAT1 binds to a conserved HB site in the target gene promoters, together with BES1 binding to BRRE, to control gene expression

Zhang D, Ye H, Guo H, Johnson A, Zhang M, Lin H, Yin Y - Transcription factor HAT1 is phosphorylated by BIN2 kinase and mediates brassinosteroid repressed gene expression in Arabidopsis

• DNA-protein Interaction

Considering the fact that SHYG and Ta-NAC69 have very high amino acid sequence similarity in their DNA binding domains, we assumed that these proteins may share similar DNA binding specificity. Previously, two high-affinity binding sites of Ta-NAC69 (site I, rrwkmCGTrnnnnnyACGtmayy; site II, rswvktynnnnnnnnyACGwcwct) were identified through in vitro binding site selection, followed by extensive mutation analysis of the two binding sites (Xue et al., 2006). To test the DNA binding affinity of SHYG to Ta-NAC69 binding sites, we determined the binding activity of SHYG toward Ta-NAC69 binding site I (SO1) and site II (SO39). In addition, to learn more about the specificity of binding, we also included the following sequences in our analysis: SO1m (mutated SO1 motif) that appears to confer no Ta-NAC69 binding affinity; SO39h that contains a sequence similar to Ta-NAC69 binding site II; ANAC019 binding site (ANAC019S); 35S motif-1 (−139 to −110) from the cauliflower mosaic virus (CaMV) 35S promoter that contains a weak Ta-NAC69 binding site I; and 35S motif-2 containing the sequence of agggatg, which is the protected site of At-NAM (Duval et al., 2002). As shown in Table 1, the binding affinities of SHYG to Ta-NAC69 sites SO1 and SO39 were highly similar to that of Ta-NAC69 (Xue et al., 2006). SHYG also showed binding toward the ANAC019 binding site and the CaMV 35S motif-1, but with higher binding affinity. In contrast with Ta-NAC69, SHYG better tolerated mutations within the two consensus motifs (SO39h and ANAC19S

Rauf M, Arif M, Fisahn J, Xue GP, Balazadeh S, Mueller-Roeber B - NAC transcription factor speedy hyponastic growth regulates flooding-induced leaf movement in Arabidopsis

• DNA-protein Interaction

to demonstrate in vivo binding of SHYG to the ACO5 promoter, we performed chromatin immunoprecipitation (ChIP) and determined enrichment of ACO5 promoter fragments in the precipitated chromatin by quantitative PCR (qPCR) with primers spanning the three predicted SHYG binding sites. We detected clear enrichment of BS-1 and BS-2, whereas no binding to BS-3 was observed

Rauf M, Arif M, Fisahn J, Xue GP, Balazadeh S, Mueller-Roeber B - NAC transcription factor speedy hyponastic growth regulates flooding-induced leaf movement in Arabidopsis

• DNA-protein Interaction

Electrophoretic mobility shift assays (EMSAs) confirmed binding of recombinant SHYG-glutathione S-transferase (SHYG-GST) fusion protein to BS-1 (Figure 1E), which has a better match to the preferred binding sequences of Ta-NAC69 than BS-2 and BS-3

Rauf M, Arif M, Fisahn J, Xue GP, Balazadeh S, Mueller-Roeber B - NAC transcription factor speedy hyponastic growth regulates flooding-induced leaf movement in Arabidopsis

• DNA-protein Interaction

Subsequently, as SMR5 and SMR7 transcription was found to depend on SOG1 (Figure 6), we tested whether both genes are under the direct control of SOG1. Direct binding of SOG1 to the SMR5 and SMR7 promoters was tested through chromatin immunoprecipitation (ChIP) using PSOG1:SOG1-Myc seedlings that were either transferred to control medium or medium supplemented with the DSB-inducing drug zeocin for 2 h. Promoter scanning revealed that SOG1 binds in a DNA stress–dependent manner to both SMR promoters in close proximity to their transcription start sites (Figures 9B and 9C). These data illustrate that both SMR genes are under direct control of SOG1

Yi D, Alvim Kamei CL, Cools T, Vanderauwera S, Takahashi N, Okushima Y, Eekhout T, Yoshiyama KO, Larkin J, Van den Daele H, Conklin P, Britt A, Umeda M, De Veylder L - The Arabidopsis SIAMESE-RELATED cyclin-dependent kinase inhibitors SMR5 and SMR7 regulate the DNA damage checkpoint in response to reactive oxygen species

• DNA-protein Interaction

Subsequently, as SMR5 and SMR7 transcription was found to depend on SOG1 (Figure 6), we tested whether both genes are under the direct control of SOG1. Direct binding of SOG1 to the SMR5 and SMR7 promoters was tested through chromatin immunoprecipitation (ChIP) using PSOG1:SOG1-Myc seedlings that were either transferred to control medium or medium supplemented with the DSB-inducing drug zeocin for 2 h. Promoter scanning revealed that SOG1 binds in a DNA stress–dependent manner to both SMR promoters in close proximity to their transcription start sites (Figures 9B and 9C). These data illustrate that both SMR genes are under direct control of SOG1

Yi D, Alvim Kamei CL, Cools T, Vanderauwera S, Takahashi N, Okushima Y, Eekhout T, Yoshiyama KO, Larkin J, Van den Daele H, Conklin P, Britt A, Umeda M, De Veylder L - The Arabidopsis SIAMESE-RELATED cyclin-dependent kinase inhibitors SMR5 and SMR7 regulate the DNA damage checkpoint in response to reactive oxygen species

• DNA-protein Interaction

chromatin immunoprecipitation (ChIP) experiments were conducted. The results from ChIP showed that WRKY57 binds to the promoters of the ... SAG12 ... via the W box sequence ... pSAG12-2

Jiang Y, Liang G, Yang S, Yu D - Arabidopsis WRKY57 functions as a node of convergence for jasmonic acid- and auxin-mediated signaling in jasmonic acid-induced leaf senescence

• DNA-protein Interaction

chromatin immunoprecipitation (ChIP) experiments were conducted. The results from ChIP showed that WRKY57 binds to the promoters of the SEN4 ... via the W box sequence ... pSEN4-2

Jiang Y, Liang G, Yang S, Yu D - Arabidopsis WRKY57 functions as a node of convergence for jasmonic acid- and auxin-mediated signaling in jasmonic acid-induced leaf senescence

• DNA-protein Interaction

AN3 occupancy was detected in the promoter and 5' UTRs of the COL5 locus with a 29-fold increase in reads

Vercruyssen L, Verkest A, Gonzalez N, Heyndrickx KS, Eeckhout D, Han SK, Jégu T, Archacki R, Van Leene J, Andriankaja M, De Bodt S, Abeel T, Coppens F, Dhondt S, De Milde L, Vermeersch M, Maleux K, Gevaert K, Jerzmanowski A, Benhamed M, Wagner D, Vandepoele K, De Jaeger G, Inzé D. - ANGUSTIFOLIA3 binds to SWI/SNF chromatin remodeling complexes to regulate transcription during Arabidopsis leaf development

• DNA-protein Interaction

Plants were transformed with CFP-tagged SWP73B constructs (35S:SWP73B-CFP) and grown until 14 DAS. Chromatin was precipitated with an anti-GFP antibody from Arabidopsis rosettes, and enrichment of selected DNA sequences was determined by qPCR. Primers annealing to the promoter regions revealed significant enrichments for the ... COL5

Vercruyssen L, Verkest A, Gonzalez N, Heyndrickx KS, Eeckhout D, Han SK, Jégu T, Archacki R, Van Leene J, Andriankaja M, De Bodt S, Abeel T, Coppens F, Dhondt S, De Milde L, Vermeersch M, Maleux K, Gevaert K, Jerzmanowski A, Benhamed M, Wagner D, Vandepoele K, De Jaeger G, Inzé D. - ANGUSTIFOLIA3 binds to SWI/SNF chromatin remodeling complexes to regulate transcription during Arabidopsis leaf development

• DNA-protein Interaction

the AN3-HBH TChAP-seq data set, obtained from cell cultures ... Although an 11-fold increase in reads was also observed in the CRF2 promoter region, no peak was called

Vercruyssen L, Verkest A, Gonzalez N, Heyndrickx KS, Eeckhout D, Han SK, Jégu T, Archacki R, Van Leene J, Andriankaja M, De Bodt S, Abeel T, Coppens F, Dhondt S, De Milde L, Vermeersch M, Maleux K, Gevaert K, Jerzmanowski A, Benhamed M, Wagner D, Vandepoele K, De Jaeger G, Inzé D. - ANGUSTIFOLIA3 binds to SWI/SNF chromatin remodeling complexes to regulate transcription during Arabidopsis leaf development

• DNA-protein Interaction

AN3 association with the transcription factor loci was further investigated in planta by ChIP. Chromatin was isolated with anti-GFP antibody from 14-d-old plants constitutively expressing a C-terminal fusion of AN3 to GFP (35S:AN3-GFP) and compared with anti-IgG ChIP-purified samples. With quantitative PCR (qPCR), a 2- to 10-fold enrichment of the promoter regions of CRF2

Vercruyssen L, Verkest A, Gonzalez N, Heyndrickx KS, Eeckhout D, Han SK, Jégu T, Archacki R, Van Leene J, Andriankaja M, De Bodt S, Abeel T, Coppens F, Dhondt S, De Milde L, Vermeersch M, Maleux K, Gevaert K, Jerzmanowski A, Benhamed M, Wagner D, Vandepoele K, De Jaeger G, Inzé D. - ANGUSTIFOLIA3 binds to SWI/SNF chromatin remodeling complexes to regulate transcription during Arabidopsis leaf development

• DNA-protein Interaction

Since TChAP-seq was performed on cell cultures, AN3 association with the transcription factor loci was further investigated in planta by ChIP. Chromatin was isolated with anti-GFP antibody from 14-d-old plants constitutively expressing a C-terminal fusion of AN3 to GFP (35S:AN3-GFP) and compared with anti-IgG ChIP-purified samples. With quantitative PCR (qPCR), a 2- to 10-fold enrichment of the promoter regions of ... HEC1

Vercruyssen L, Verkest A, Gonzalez N, Heyndrickx KS, Eeckhout D, Han SK, Jégu T, Archacki R, Van Leene J, Andriankaja M, De Bodt S, Abeel T, Coppens F, Dhondt S, De Milde L, Vermeersch M, Maleux K, Gevaert K, Jerzmanowski A, Benhamed M, Wagner D, Vandepoele K, De Jaeger G, Inzé D. - ANGUSTIFOLIA3 binds to SWI/SNF chromatin remodeling complexes to regulate transcription during Arabidopsis leaf development

• DNA-protein Interaction

Plants were transformed with CFP-tagged SWP73B constructs (35S:SWP73B-CFP) and grown until 14 DAS. Chromatin was precipitated with an anti-GFP antibody from Arabidopsis rosettes, and enrichment of selected DNA sequences was determined by qPCR. Primers annealing to the promoter regions revealed significant enrichments for the ... CRF2

Vercruyssen L, Verkest A, Gonzalez N, Heyndrickx KS, Eeckhout D, Han SK, Jégu T, Archacki R, Van Leene J, Andriankaja M, De Bodt S, Abeel T, Coppens F, Dhondt S, De Milde L, Vermeersch M, Maleux K, Gevaert K, Jerzmanowski A, Benhamed M, Wagner D, Vandepoele K, De Jaeger G, Inzé D. - ANGUSTIFOLIA3 binds to SWI/SNF chromatin remodeling complexes to regulate transcription during Arabidopsis leaf development

• DNA-protein Interaction

Plants were transformed with CFP-tagged SWP73B constructs (35S:SWP73B-CFP) and grown until 14 DAS. Chromatin was precipitated with an anti-GFP antibody from Arabidopsis rosettes, and enrichment of selected DNA sequences was determined by qPCR. Primers annealing to the promoter regions revealed significant enrichments for the ... GRF5

Vercruyssen L, Verkest A, Gonzalez N, Heyndrickx KS, Eeckhout D, Han SK, Jégu T, Archacki R, Van Leene J, Andriankaja M, De Bodt S, Abeel T, Coppens F, Dhondt S, De Milde L, Vermeersch M, Maleux K, Gevaert K, Jerzmanowski A, Benhamed M, Wagner D, Vandepoele K, De Jaeger G, Inzé D. - ANGUSTIFOLIA3 binds to SWI/SNF chromatin remodeling complexes to regulate transcription during Arabidopsis leaf development

• DNA-protein Interaction

Since TChAP-seq was performed on cell cultures, AN3 association with the transcription factor loci was further investigated in planta by ChIP. Chromatin was isolated with anti-GFP antibody from 14-d-old plants constitutively expressing a C-terminal fusion of AN3 to GFP (35S:AN3-GFP) and compared with anti-IgG ChIP-purified samples ... the presence of AN3 was also shown at its own promoter

Vercruyssen L, Verkest A, Gonzalez N, Heyndrickx KS, Eeckhout D, Han SK, Jégu T, Archacki R, Van Leene J, Andriankaja M, De Bodt S, Abeel T, Coppens F, Dhondt S, De Milde L, Vermeersch M, Maleux K, Gevaert K, Jerzmanowski A, Benhamed M, Wagner D, Vandepoele K, De Jaeger G, Inzé D. - ANGUSTIFOLIA3 binds to SWI/SNF chromatin remodeling complexes to regulate transcription during Arabidopsis leaf development

• DNA-protein Interaction

Plants were transformed with CFP-tagged SWP73B constructs (35S:SWP73B-CFP) and grown until 14 DAS. Chromatin was precipitated with an anti-GFP antibody from Arabidopsis rosettes, and enrichment of selected DNA sequences was determined by qPCR. Primers annealing to the promoter regions revealed significant enrichments for the ... ARR4

Vercruyssen L, Verkest A, Gonzalez N, Heyndrickx KS, Eeckhout D, Han SK, Jégu T, Archacki R, Van Leene J, Andriankaja M, De Bodt S, Abeel T, Coppens F, Dhondt S, De Milde L, Vermeersch M, Maleux K, Gevaert K, Jerzmanowski A, Benhamed M, Wagner D, Vandepoele K, De Jaeger G, Inzé D. - ANGUSTIFOLIA3 binds to SWI/SNF chromatin remodeling complexes to regulate transcription during Arabidopsis leaf development

• DNA-protein Interaction

Plants were transformed with CFP-tagged SWP73B constructs (35S:SWP73B-CFP) and grown until 14 DAS. Chromatin was precipitated with an anti-GFP antibody from Arabidopsis rosettes, and enrichment of selected DNA sequences was determined by qPCR. Primers annealing to the promoter regions revealed significant enrichments for the AN3

Vercruyssen L, Verkest A, Gonzalez N, Heyndrickx KS, Eeckhout D, Han SK, Jégu T, Archacki R, Van Leene J, Andriankaja M, De Bodt S, Abeel T, Coppens F, Dhondt S, De Milde L, Vermeersch M, Maleux K, Gevaert K, Jerzmanowski A, Benhamed M, Wagner D, Vandepoele K, De Jaeger G, Inzé D. - ANGUSTIFOLIA3 binds to SWI/SNF chromatin remodeling complexes to regulate transcription during Arabidopsis leaf development

• DNA-protein Interaction

Since TChAP-seq was performed on cell cultures, AN3 association with the transcription factor loci was further investigated in planta by ChIP. Chromatin was isolated with anti-GFP antibody from 14-d-old plants constitutively expressing a C-terminal fusion of AN3 to GFP (35S:AN3-GFP) and compared with anti-IgG ChIP-purified samples. With quantitative PCR (qPCR), a 2- to 10-fold enrichment of the promoter regions of ... COL5

Vercruyssen L, Verkest A, Gonzalez N, Heyndrickx KS, Eeckhout D, Han SK, Jégu T, Archacki R, Van Leene J, Andriankaja M, De Bodt S, Abeel T, Coppens F, Dhondt S, De Milde L, Vermeersch M, Maleux K, Gevaert K, Jerzmanowski A, Benhamed M, Wagner D, Vandepoele K, De Jaeger G, Inzé D. - ANGUSTIFOLIA3 binds to SWI/SNF chromatin remodeling complexes to regulate transcription during Arabidopsis leaf development

• DNA-protein Interaction

Since TChAP-seq was performed on cell cultures, AN3 association with the transcription factor loci was further investigated in planta by ChIP. Chromatin was isolated with anti-GFP antibody from 14-d-old plants constitutively expressing a C-terminal fusion of AN3 to GFP (35S:AN3-GFP) and compared with anti-IgG ChIP-purified samples ... the presence of AN3 was also shown at ... the promoters of GRF5

Vercruyssen L, Verkest A, Gonzalez N, Heyndrickx KS, Eeckhout D, Han SK, Jégu T, Archacki R, Van Leene J, Andriankaja M, De Bodt S, Abeel T, Coppens F, Dhondt S, De Milde L, Vermeersch M, Maleux K, Gevaert K, Jerzmanowski A, Benhamed M, Wagner D, Vandepoele K, De Jaeger G, Inzé D. - ANGUSTIFOLIA3 binds to SWI/SNF chromatin remodeling complexes to regulate transcription during Arabidopsis leaf development

• DNA-protein Interaction

AN3 occupancy was detected in ... steep peak corresponding to a fold change of around 19 was observed in the promoter region of HEC1

Vercruyssen L, Verkest A, Gonzalez N, Heyndrickx KS, Eeckhout D, Han SK, Jégu T, Archacki R, Van Leene J, Andriankaja M, De Bodt S, Abeel T, Coppens F, Dhondt S, De Milde L, Vermeersch M, Maleux K, Gevaert K, Jerzmanowski A, Benhamed M, Wagner D, Vandepoele K, De Jaeger G, Inzé D. - ANGUSTIFOLIA3 binds to SWI/SNF chromatin remodeling complexes to regulate transcription during Arabidopsis leaf development

• DNA-protein Interaction

BRM ChIP was performed with an anti-HA antibody on 9-d-old transgenic plants expressing biologically active HA-tagged BRM (Han et al., 2012). A strong enrichment was observed for the promoter of HEC1 in BRM-HA shoots, while no significant differences were found for AN3, GRF3, GRF5, GRF6, or HB33 promoter regions compared with anti-HA ChIP from wild-type plants

Vercruyssen L, Verkest A, Gonzalez N, Heyndrickx KS, Eeckhout D, Han SK, Jégu T, Archacki R, Van Leene J, Andriankaja M, De Bodt S, Abeel T, Coppens F, Dhondt S, De Milde L, Vermeersch M, Maleux K, Gevaert K, Jerzmanowski A, Benhamed M, Wagner D, Vandepoele K, De Jaeger G, Inzé D. - ANGUSTIFOLIA3 binds to SWI/SNF chromatin remodeling complexes to regulate transcription during Arabidopsis leaf development

• DNA-protein Interaction

Peaks could be detected along the coding regions of the ... COL5 AN3-HBH sample, while the number of reads was low in the corresponding genomic regions of the control sample ... resulting in a 35-fold enrichment of reads

Vercruyssen L, Verkest A, Gonzalez N, Heyndrickx KS, Eeckhout D, Han SK, Jégu T, Archacki R, Van Leene J, Andriankaja M, De Bodt S, Abeel T, Coppens F, Dhondt S, De Milde L, Vermeersch M, Maleux K, Gevaert K, Jerzmanowski A, Benhamed M, Wagner D, Vandepoele K, De Jaeger G, Inzé D. - ANGUSTIFOLIA3 binds to SWI/SNF chromatin remodeling complexes to regulate transcription during Arabidopsis leaf development

• DNA-protein Interaction

Plants were transformed with CFP-tagged SWP73B constructs (35S:SWP73B-CFP) and grown until 14 DAS. Chromatin was precipitated with an anti-GFP antibody from Arabidopsis rosettes, and enrichment of selected DNA sequences was determined by qPCR. Primers annealing to the promoter regions revealed significant enrichments for the ... GRF3

Vercruyssen L, Verkest A, Gonzalez N, Heyndrickx KS, Eeckhout D, Han SK, Jégu T, Archacki R, Van Leene J, Andriankaja M, De Bodt S, Abeel T, Coppens F, Dhondt S, De Milde L, Vermeersch M, Maleux K, Gevaert K, Jerzmanowski A, Benhamed M, Wagner D, Vandepoele K, De Jaeger G, Inzé D. - ANGUSTIFOLIA3 binds to SWI/SNF chromatin remodeling complexes to regulate transcription during Arabidopsis leaf development

• DNA-protein Interaction

Peaks could be detected along the coding regions of the CRF2 ... AN3-HBH sample, while the number of reads was low in the corresponding genomic regions of the control sample ... resulting in a 35-fold enrichment of reads

Vercruyssen L, Verkest A, Gonzalez N, Heyndrickx KS, Eeckhout D, Han SK, Jégu T, Archacki R, Van Leene J, Andriankaja M, De Bodt S, Abeel T, Coppens F, Dhondt S, De Milde L, Vermeersch M, Maleux K, Gevaert K, Jerzmanowski A, Benhamed M, Wagner D, Vandepoele K, De Jaeger G, Inzé D. - ANGUSTIFOLIA3 binds to SWI/SNF chromatin remodeling complexes to regulate transcription during Arabidopsis leaf development

• DNA-protein Interaction

Since TChAP-seq was performed on cell cultures, AN3 association with the transcription factor loci was further investigated in planta by ChIP. Chromatin was isolated with anti-GFP antibody from 14-d-old plants constitutively expressing a C-terminal fusion of AN3 to GFP (35S:AN3-GFP) and compared with anti-IgG ChIP-purified samples ... the presence of AN3 was also shown at ... the promoters of ... ARR4

Vercruyssen L, Verkest A, Gonzalez N, Heyndrickx KS, Eeckhout D, Han SK, Jégu T, Archacki R, Van Leene J, Andriankaja M, De Bodt S, Abeel T, Coppens F, Dhondt S, De Milde L, Vermeersch M, Maleux K, Gevaert K, Jerzmanowski A, Benhamed M, Wagner D, Vandepoele K, De Jaeger G, Inzé D. - ANGUSTIFOLIA3 binds to SWI/SNF chromatin remodeling complexes to regulate transcription during Arabidopsis leaf development

• DNA-protein Interaction

Since TChAP-seq was performed on cell cultures, AN3 association with the transcription factor loci was further investigated in planta by ChIP. Chromatin was isolated with anti-GFP antibody from 14-d-old plants constitutively expressing a C-terminal fusion of AN3 to GFP (35S:AN3-GFP) and compared with anti-IgG ChIP-purified samples ... the presence of AN3 was also shown at ... the promoters of ... GRF6

Vercruyssen L, Verkest A, Gonzalez N, Heyndrickx KS, Eeckhout D, Han SK, Jégu T, Archacki R, Van Leene J, Andriankaja M, De Bodt S, Abeel T, Coppens F, Dhondt S, De Milde L, Vermeersch M, Maleux K, Gevaert K, Jerzmanowski A, Benhamed M, Wagner D, Vandepoele K, De Jaeger G, Inzé D. - ANGUSTIFOLIA3 binds to SWI/SNF chromatin remodeling complexes to regulate transcription during Arabidopsis leaf development

• DNA-protein Interaction

Plants were transformed with CFP-tagged SWP73B constructs (35S:SWP73B-CFP) and grown until 14 DAS. Chromatin was precipitated with an anti-GFP antibody from Arabidopsis rosettes, and enrichment of selected DNA sequences was determined by qPCR. Primers annealing to the promoter regions revealed significant enrichments for the ... HEC1

Vercruyssen L, Verkest A, Gonzalez N, Heyndrickx KS, Eeckhout D, Han SK, Jégu T, Archacki R, Van Leene J, Andriankaja M, De Bodt S, Abeel T, Coppens F, Dhondt S, De Milde L, Vermeersch M, Maleux K, Gevaert K, Jerzmanowski A, Benhamed M, Wagner D, Vandepoele K, De Jaeger G, Inzé D. - ANGUSTIFOLIA3 binds to SWI/SNF chromatin remodeling complexes to regulate transcription during Arabidopsis leaf development

• DNA-protein Interaction

Our result also shows that the enrichment in KAN1-ChIP was dependent on the specific KBX fragment tested; for example, only one of two KBX-containing regions of the HAT2 promoter (HAT2b) appeared to be associated with KAN1-GR (Figure 5), which suggests that KBX alone is not sufficient for KAN1 binding

Huang T, Harrar Y, Lin C, Reinhart B, Newell NR, Talavera-Rauh F, Hokin SA, Barton MK, Kerstetter RA - Arabidopsis KANADI1 acts as a transcriptional repressor by interacting with a specific cis-element and regulates auxin biosynthesis, transport, and signaling in opposition to HD-ZIPIII factors

• DNA-protein Interaction

Using a genome-wide chromatin-immunoprecipitation sequencing approach (ChIP-Seq), we recently identified binding regions for REV across the Arabidopsis genome (Brandt et al., 2012). This analysis revealed binding of REV to the promoter of the WRKY53 transcription factor

Xie Y, Huhn K, Brandt R, Potschin M, Bieker S, Straub D, Doll J, Drechsler T, Zentgraf U, Wenkel S - REVOLUTA and WRKY53 connect early and late leaf development in Arabidopsis